Dissertações/Teses

Clique aqui para acessar os arquivos diretamente da Biblioteca Digital de Teses e Dissertações da UFPA

2024
Descrição
  • ADRINY DOS SANTOS MIRANDA LOBATO
  • COMPOSIÇÃO DE VITAMINAS E COLESTEROL EM TECIDOS DE BOVINOS TERMINADOS NO PERÍODO CHUVOSO DA AMAZÔNIA ORIENTAL

  • Data: 15/03/2024
  • Mostrar Resumo
  • O consumo de carne bovina está diretamente atrelado à saúde humana, por apresentar inúmeros benefícios, dentre eles, a ingestão de vitaminas lipossolúveis, como a A e E, que desencadeiam a regulação da vida. Entretanto, o consumo de altos níveis desses alimentos são atrelados aos níveis elevados de colesterol. Os produtores e responsáveis pelos sistemas de criação, precisam pensar cada vez mais na quantidade e qualidade dos nutrientes administrados e gerados pelos animais. O que justifica a elaboração da presente pesquisa, pois a partir de análises laboratoriais, foi possível quantificar e caracterizar o valor vitamínico e de colesterol do músculo e fígado de bovinos. Assim, este trabalho visa definir o efeito de diferentes sistemas de criação de bovinos Nelore cruzados, machos, não castrados, na Amazônia Oriental, durante o período chuvoso, nos níveis de β- Caroteno e vitamina E e colesterol no músculo e tecido hepático. Foram coletadas amostras de doze bovinos, em frigoríferos comerciais, de cada grupo experimental, representados por quatro sistemas de criação, dos quais dois são em pastagens nativas, uma cultivada (Sistemas extensivos), e um em confinamento (Sistema intensivo). As amostras foram analisadas pela Cromatografia Líquida de Alta Eficiência (CLAE). Não foi possível identificar diferença nos níveis de vitaminas e colesterol entre os quatro sistemas de criação (P>0.05). No entanto, no comparativo entre o sistema intensivo e extensivo, foi possível identificar diferenças significativas, com destaque-se no músculo com teor superior de β-Caroteno (P<0.01) no sistema intensivo; além do conteúdo superior de α-tocoferol (P=0.02) e δ-tocoferol (P<0.01) para o sistema extensivo; No que concerne o fígado, destaca-se o sistema intensivo, com altos teores de β-Caroteno (P<0.01), α-Tocoferol (P=0.01), β-Tocoferol (P=0,01), no entanto com níveis inferiores de colesterol (P=0.01) para o sistema extensivo. Assim, os bovinos terminados em sistemas de criação da Amazônia Oriental, quando comparados os sistemas extensivos e intensivo, influenciam os teores de β- Caroteno, vitamina E e colesterol, tanto no músculo com fígado, com destaques distintos para determinados sistemas quando avaliado o composto selecionado. No entanto, a inclusão desses produtos animais na dieta humana deve ser orientada por um profissional habilitado.

  • JHUSICLEIDE DA SILVA E SILVA
  • Respostas comportamentais, musculares, cardíacas e hematológicas de juvenis de tambaqui Colossoma macropomum anestesiados com eucaliptol

     

  • Data: 05/03/2024
  • Mostrar Resumo
  • Este estudo teve como objetivo avaliar a eficácia anestésica e a segurança do eucaliptol na promoção de imobilização corporal completa (anestesia), relaxamento muscular e atividade cardíaca em juvenis de tambaqui Colossoma macropomum. Peixes com peso médio de 30,8 ± 4,3 g e comprimento de 11,9 ± 0,7 cm foram utilizados neste estudo. Inicialmente, os espécimes foram submetidos a banhos anestésicos com diferentes concentrações de eucaliptol (300, 400, 500, 600, 700 e 800 µL.L–1) para avaliação comportamental. Em seguida, concentrações de eucaliptol à 600, 700 e 800 µL.L–1 foram selecionadas, arbitrariamente, para exposição dos animais e registros eletrofisiológicos (EMG e ECG) ao longo de 300 s. Ainda, amostras de sangue foram coletadas antes e após a anestesia com 700 µL.L–1 de eucaliptol para análises de respostas hematológicas. Um total de 10 juvenis foram utilizados em cada teste e registro, divididos em três grupos: a) controle (registro basal), b) peixes expostos apenas à água adicionada do veículo (etanol) e c) peixes submetidos à indução e subsequente recuperação com eucaliptol. Os resultados demonstraram que concentrações mais elevadas de eucaliptol foram mais eficazes na promoção de imobilização corporal completa (anestesia). O EMG evidenciou que o poder de contração muscular durante a indução diminuiu significativamente nas três concentrações testadas, indicando um relaxamento muscular pronunciado. O ECG demonstrou uma redução significativa na frequência cardíaca nos peixes induzidos com 700 µL.L–1 (41 ± 4 BPM) e 800 µL.L–1 de ECL (35 ± 5 BPM). Os traçados resultantes da exposição às concentrações de eucaliptol (600, 700 e 800 µL.L–1 de ECL) revelaram uma leve arritmia, com bradicardia, porém reversíveis. Todos os animais retornaram gradualmente ao ritmo sinusal dentro do limite de tempo adequado, sugerindo uma condição segura para a recuperação em todas as concentrações. Os resultados hematológicos demonstraram que apenas a glicose (146,625 ± 30,95 mg.dL–1) teve uma alteração significativa em comparação aos grupos controle (76 ± 19,94 mg.dL–1) e etanol (97,5 ± 16,15 mg.dL–1), ocorrendo a retomada da homeostase após a manipulação. Em conclusão, o eucaliptol foi eficiente para promover anestesia, induzindo a imobilização corporal completa de C. macropomum em concentrações que variaram de 300 a 800 µL.L–1, em tempos considerados adequados de indução e recuperação. Concentrações de 600 a 800 µL.L–1 induziram um relaxamento muscular pronunciado e depressão cardíaca sem risco à vida. O eucaliptol pode atuar com segurança e, de modo reversível, como um agente anestésico para uso em procedimentos não invasivos em tambaquis e potencialmente em outras espécies de teleósteos.

  • MICHEL SANTOS E CUNHA
  • ESTUDO ANATÔMICO IMAGINOLÓGICO DO BICHO-PREGUIÇA JOVEM, (Bradypus variegatus SCHINZ,1825) POR TOMOGRAFIA E RADIOLOGIA: MODELO ANATÔMICO PARA ESTUDO DE TECIDO MOLE, DO ESQUELETO APENDICULAR E AVALIAÇÃO PÉLVICA

     

  • Data: 29/02/2024
  • Mostrar Resumo
  • O trabalho foi divido em três etapas: A primeira consistiu em realizar estudos tomográficos e avaliar o contraste nos cadáveres glicerinados e congelados. Durante essa etapa, foi possível avaliar o preenchimento de vários vasos sanguíneos por meio do contraste vascular, além de revelar alguns órgãos através do uso de contraste oral. Foi observado que nos espécimes glicerinados, a técnica utilizada permitiu a visualização de imagens semelhantes às obtidas com o uso de um contraste mais avançado. Isso indica que a técnica utilizada para os cadáveres glicerinados foi eficaz na obtenção de resultados satisfatórios. Na segunda etapa foi realizada a descrição do esqueleto apendicular da espécie Bradypus variegatus. Durante essa análise foram identificadas particularidades no desenvolvimento ósseo desses espécimes, que ainda não haviam sido descritas anteriormente. Essas particularidades incluem formações ósseas que não seguem um padrão de ossificação e que variam até mesmo dentro da própria espécie. Através desse estudo, foi possível compreender que o estilo de vida desses animais exerce uma influência significativa na formação óssea. Na terceira etapa, por meio da pelvimetria, utilizando a tomografia e radiologia, para compreender as dimensões pélvicas da espécie Bradypus variegatus e identificar quais medidas contribuem para a determinação da idade nesses animais. Por meio dessa análise, foi possível constatar que a pelve apresenta um crescimento significativo em largura, principalmente na parte interna. Essa dinâmica de crescimento está diretamente relacionada ao modo de vida desses animais. Sendo assim o estudo tomográfico e radiológico revelou características anatômicas importantes para entender a qualidade de vida, saúde e biologia dessa espécie.

2023
Descrição
  • ANA PAULA DAMASCENO FERREIRA
  • Composicao mineral em tecidos de bovinos terminados no período chuvoso em sistemas de criacao da amazonia oriental

  • Data: 15/12/2023
  • Mostrar Resumo
  • Objetivou-se com o presente estudo avaliar a influência dos principais sistemas de criação da Amazônia Oriental no conteúdo mineral da carne e fígado de bovinos terminados no período chuvoso do ano. Foram utilizados quarenta e oito nelores mestiços, abatidos com peso entre 370 e 600 kg, e idades compreendidas entre 24 a 48 meses, criados em pastagem nativa, cultivada e em confinamento. Os tratamentos foram representados por quatro sistemas de criação: Pastagem nativa, em Santa Cruz do Arari (Mesorregião de Marajó); Pastagem nativa de várzea, em Monte Alegre (Mesorregião do Baixo Amazonas); Pastagem cultivada, em terra firme em São Miguel do Guamá (Mesorregião Nordeste Paraense); e Confinamento, em Santa Isabel (Mesorregião Metropolitana de Belém). Foram coletados cerca de 100 g de músculo Longissimus lumborum e tecido hepático de doze bovinos, de cada tratamento, em abatedouros licenciados, seguindo todos os padrões sanitários da legislação vigente para abate comercial de bovinos. Em seguida, as amostras foram armazenadas e congeladas a -80 °C, até a liofilização. Também, foram coletadas amostras de solo, dietas ofertadas (pastagem e concentrado). O preparo das amostras e análises de minerais foram realizadas no Instituto Superior de Agronomia da Universidade de Lisboa, a partir de leituras de espectrometria de emissão óptica de plasma acoplado indutivamente (ICPOES), em Thermo Scientific iCAP 7000. As amostras de solo foram analisadas quanto ao perfil físico-químico e nos alimentos determinou-se a composição centesimal, através da análise bromatológica. Os principais sistemas de criação de bovinos na Amazônia Oriental influenciaram o conteúdo de todos os elementos minerais presentes na carne e fígado bovino. Houve diferença (p<0.05) na concentração dos macrominerais e microminerais presente no músculo dos bovinos, com superioridade dos elementos potássio (K), magnésio (Mg), fósforo (P) e enxofre (S), na carne dos bovinos criados em São Miguel do Guamá. Valores máximos de sódio (Na), 52,16 mg/g, e cálcio (Ca), 10,20 mg/g, foram observados na carne dos animais em sistema extensivo de Santa Cruz do Arari. Teores de microminerais foram destaques no tecido dos animais criados extensivamente, como em Monte Alegre, com valores altos de zinco (Zn), 2,78 mg/g, e ferro (Fe), 1,49 mg/g, e em Santa Cruz do Arari, com níveis elevados de cobre (Cu) e manganês (Mn). O fígado bovino, também, apresentou diferenças (p<0.05) nas concentrações de todos os minerais. Maiores conteúdos de Na, S, Mg, Zn e Fe foram constatados no fígado de bovinos de Santa Cruz do Arari, assim como o Ca, com valor de 8.47 mg/g e o Mn com 1,4 mg/g no tecido hepático de bovinos criados extensivamente em Monte Alegre. Contudo, a concentração de K e P foram evidentes em pastagem cultivada de São Miguel do Guamá. O elemento mineral Cu foi significativamente superior, com valor de 6,0 mg/g, no fígado dos bovinos em sistema intensivo de confinamento. Independente do sistema de criação adotado, a carne e o fígado bovino terminados no período chuvoso na Amazônia Oriental é excelente fonte de minerais.

  • ARTHUR DOS SANTOS DA SILVA
  • Suplementação dietética com óleo essencial de Citrus sinensis para Colossoma macropomum

  • Orientador : CARLOS ALBERTO MARTINS CORDEIRO
  • Data: 30/11/2023
  • Mostrar Resumo
  • O óleo essencial de Citrus sinensis tem ação imunoestimulante e promoter de crescimento em peixes, contudo, não informações sobre o potencial benéfico desse óleo na dieta para a espécie nativa C. macropomum. Assim, o objetivo deste estudo foi avaliar o efeito da suplementação dietética de óleo essencial de laranja doce (C. sinensis) no crescimento e sistema imunológico dos alevinos de C. macropomum e a resistência a A. hydrophila. O experimento foi realizado com quatro repetição e cinco tratamentos (dieta controle, dieta com Tweenn, dieta com suplementação de 200, 400 e 800 mg.L-1 OE C. sinensis). Ao final do período experimental, determinou-se os parâmetros de crescimento, e coletou-se amostras de sangue para análise de trombograma, leucograma e atividade fagocítica. Assim como, realizou-se um desafio bacteriano com A. hydrophila por 96h. Os alevinos de C. macropomum que foram alimentados com 400 e 800 mg.L-1 OE de C. sinensis, tiveram os maiores valores nos parâmetros de crescimento, com peso final de 533,18±2,03 e 531,91±2,67 mg, aumento no número de células de trombócito, linfócito, monócito, neutrófilo e aumento na taxas de fagocitose em comparação ao grupo controle. Em relação ao desafio, os peixes desses dois tratamentos tiveram a menor taxa de mortalidade acumulativa (26,66±3,33%). Portando, a suplementação do OE de C. sinensis promove o crescimento, melhora na saúde e resistência a A. hydrophila dos alevinos de C. macropomum.

  • MURILO SALLES DA CONCEICAO
  • EFEITO DE NÍVEIS DE CÁLCIO DIETÉTICO SOBRE A MORFOLOGIA E MORFOMETRIA DO ÚTERO DE Kinosternon scorpioides NA PÓS-POSTURA

  • Data: 29/11/2023
  • Mostrar Resumo
  • A quelonicultura na Amazônia representa uma atividade economica potencial para a região, devido a prolificidade, rusticidade e  o valor comercial das espécies manejadas, como é o caso do Kinosternon scorpioides, muçuã. Um aspecto importante no sistema de criação é a nutrição, sendo que a suplementação excessiva ou a insuficiência de cálcio na dieta pode interferir no crescimento, reprodução e absorção de outros minerais. O objetivo deste trabalho foi avaliar a influência de diferentes níveis dietéticos de cálcio na morfologia do útero de fêmeas de K. scorpioides na pós-postura. As amostras foram obtidas de quinze fêmeas adultas provenientes de um experimento realizado anteriormente; no qual os animais foram suplementados com rações de cinco tratamentos de níveis de cálcio (1,7; 2,7; 3,7; 4,7 e 5,7%), cada um com três repetições. Para as observações morfológicas e morfométricas, foram retirados segmentos de 0,5 cm do útero. As amostras foram coradas com Alizarina, e Hematoxilina e Eosina, em seguida analisadas por microscopia óptica. Macroscopicamente, a mucosa uterina apresentou invaginações formando dobras de diferentes alturas e larguras. Microscopicamente, o útero apresentou um epitélio cilíndrico simples, com células ciliadas e não ciliadas. A lâmina própria formada por tecido conjuntivo denso, com a presença de glândulas uterinas. Abaixo da mucosa foram observadas duas camadas musculares lisa, a interna formada por fibras circulares e a externa por fibras longitudinais. Houve um aumento progressivo da altura e do número das dobras da mucosa relacionado com a inclusão dos níveis de cálcio dietético. Possivelmente, a ampliação da área da mucosa ocorreu para permitir maior fornecimento de substâncias para a formação dos ovos, colaborando deste modo para o sucesso nas taxas de posturas. Tal fato corrobora com o experimento nutricional de onde as amostras foram obtidas, que atestou que o nível de cálcio recomendado para esta espécie é de 4,2%, em fase de postura. A inclusão de diferentes níveis de cálcio na dieta de K. scorpioides mostrou que há influência no aumento mucosa uterina, sugerindo que essa característica leve a passagem de maior quantidade deste mineral para a formação dos ovos. As modificações da mucosa uterina ocorrem sob influência do cálcio, inferindo que estão relacionadas com a produção de ovos, sendo, portanto, necessária a suplementação deste mineral para a melhoria dos parâmetros reprodutivos da espécie. 

  • RENATA SILVA DE OLIVEIRA
  • Efeitos da substituição de farinha de peixe pelo concentrado proteico de soja na dieta de alevinos de Arapaima gigas (Shinz,1822)

     

  • Data: 29/11/2023
  • Mostrar Resumo
  • Na aquicultura, derivados da soja têm sido reconhecidos como fontes proteicas alternativas mais adequadas para produção de dietas. Contudo, fatores antinutricionais que podem gerar efeitos negativos sobre o crescimento dos peixes. O processamento da soja permite a obtenção de Farelo de soja (FS) e produtos mais refinados, como o Concentrado Proteico de Soja (CPS). Diante disso, neste estudo avaliamos os efeitos da substituição de farinha de peixe (FP), pelo CPS e pelo FS em dietas para juvenis de pirarucu, sendo avaliado o desempenho de crescimento, a atividade das enzimas digestivas, a morfologia intestinal e hepática dos peixesForam realizados dois experimentos em períodos distintos, ambos com duração de 60 dias. O primeiro realizado em 2019, utilizando 132 pirarucus juvenis em três tratamentos (FP, CPS e FS) e quatro repetições. Os animais alimentados com a dieta FP apresentaram em média o maior ganho de peso e taxa de crescimento específico diferindo estatisticamente das dietas com farelo de soja e concentrado proteico de soja. Enquanto, a conversão alimentar aparente apresentou melhores valores nos tratamentos CPS e FS. Para os valores de índice hepatossomático (IHS), índice viscerossomático (IVS) e índice estomagossomático (IES) não houve alterações significativas entre os tratamentos. Pelas análises histológicas do fígado e do intestino dos peixes foram evidenciadas alterações hepáticas e intestinais nos tratamentos CPS e FS.  Já no segundo experimento realizado em 2021, substituindo farinha de peixe por concentrado proteico de soja em níveis crescentes (0 (0%), 11,2 (25%), 22,5 (50%), 33,7 (75%) e 45 (100%)), foi observado que os animais alimentados com as dietas 0 e 11,2 apresentaram em média o maior ganho de peso e taxa de crescimento específico. Enquanto, a conversão alimentar aparente apresentou maiores valores nos tratamentos 22,5, 33,7 e 45. Os valores dos índices hepatossomático (IHS), índice viscerossomático (IVS), índice intestinossomático (IIS), e índice estomagossomático (IES) evidenciaram alterações significativas entre os tratamentos. Pelas análises histológicas do fígado e do intestino dos peixes apresentaram dano hepático e alterações nas vilosidades intestinais nos tratamentos 22,5, 33,7 e 45. Em relação as atividades enzimáticas mudanças foram observadas a partir do aumento do nível de substituição de farinha de peixe por concentrado proteico de soja. Porém a substituição da farinha de peixe em até 25% promoveu um bom desempenho de crescimento e não afetou a morfologia hepática e intestinal

  • WESLEY DOS SANTOS LIMA
  • INCLUSÃO DE FARINHA DE INSETO (Gromphadorhina portentosa) EM SUBSTITUIÇÃO AO FARELO DE SOJA EM DIETAS PARA ALEVINOS DO PEIXE ORNAMENTAL AMAZÔNICO Heros severos

  • Data: 06/11/2023
  • Mostrar Resumo
  • A utilização da farinha de insetos na alimentação de peixes de cativeiro vem conquistando cada vez mais espaço na piscicultura ornamental. Os marcos regulatórios sobre o uso na nutrição animal, comprovações científicas acerca do potencial nutritivo, por ser um ingrediente alternativo aos tradicionais que tem altos preços e oferta instável para uso em rações aquícolas são alguns dos pontos que solidificam sua aplicabilidade. Além disso, os insetos fazem parte da alimentação natural de diversos peixes, incluindo o acará severo (Heros severus), porém ainda não existem informações sobre os efeitos da substituição de farelo de soja pela de farinha de inseto em dietas no desempenho da espécie. Perante o exposto, o objetivo do estudo é avaliar o desempenho produtivo e a histomorfometria intestinal de alevinos de acará severo alimentados com dietas contendo níveis de substituição de farelo de soja pela farinha de inseto (Gromphardorhina portentosa). Cinco dietas foram formuladas e apresentaram 40,18 ± 0,12% de proteína bruta e 4.120,49 ± 1,70 kcal/kg de energia bruta. Foram formuladas com níveis crescentes de 0, 7, 14, 21 e 28% de farinha de barata de Madagascar em substituição ao farelo de soja, apresentando valores percentuais de substituição de 0, 25, 50, 75 e 100%. O experimento foi conduzido em delineamento inteiramente casualizado com cinco tratamentos e três repetições, 300 pós-larvas de acará severo que foram distribuídas aleatoriamente em 15 unidades experimentais e alimentadas na frequência alimentar de quatro vezes ao dia durante 60 dias. Ao final do experimento, os peixes foram pesados, medidos e contados para a determinação dos parâmetros de desempenho produtivo e histomorfometria do intestino, para avaliar os efeitos da inclusão da farinha de barata de Madagascar em substituição ao farelo de soja. No presente estudo foi observado que os níveis de inclusão da farinha de inseto estimados entre 9,13 e 9,88% melhorou os parâmetros de comprimento dos peixes. Já para os parâmetros de peso, os níveis estimados foram entre 9,55 e 10,55%. Esses valores correspondem a níveis de substituição de 32,61% a 37,61% do farelo de soja. A inclusão de 10,11% a 13,42% de farinha de inseto, correspondendo a substituições de 36,10% a 47,93% do farelo de soja nas dietas, resultou em maiores valores de altura, espessura e perímetro das vilosidades, além de maior espessura da túnica intestinal dos peixes. Dessa forma, é possível indicar que a farinha de inseto (G. portentosa) pode ser utilizada em níveis de 9,13% a 13,42% nas dietas para primeira alimentação seca de alevinos de acará severo.

  • ITALO ANTONIO DE FREITAS LUTZ
  • FERRAMENTAS MOLECULARES, BASEADAS EM DNA, PARA IDENTIFICAÇÃO E AUTENTICAÇÃO DE PEIXES E PRODUTOS PROCESSADOS DE PESCADO NA AMAZÔNIA COSTEIRA

  • Data: 03/11/2023
  • Mostrar Resumo
  • Os peixes são importantes recursos, promovendo produção de alimento e renda para diversas comunidades e países em todo o mundo. Entretanto, problemas de reconhecimento das espécies e identificação inequívoca, além de fraudes comerciais em produtos processados, ainda são gargalos para inúmeros grupos, que precisam ser solucionados, especialmente em regiões da Amazônia costeira. Assim, de seis capítulos presentes nesta tese, quatro foram produzidos no formato de artigos para publicação em periódicos internacionais de vasto alcance para comunidade científica, discutindo questões relacionadas a investigação de diversidade de peixes da Amazônia e de fiscalização forense, através de ferramentas baseadas em DNA, a começar pela obtenção de material genético com níveis de pureza e integridade adequados para análises com pescado. O primeiro artigo científico comparou três protocolos diferentes de extração de DNA: NaCl (salino); fenol-clorofórmio e kit comercial (Promega), utilizando três diferentes tecidos biológicos, sob dois métodos de armazenamento, da espécie Lutjanus purpureus, o pargo vermelho do Atlântico Sul Ocidental. Enquanto o procedimento com fenol-clorofórmio apresentou os piores resultados em relação ao rendimento do DNA e tempo de processamento, os protocolos salino e do kit comercial apresentaram resultados semelhantes no que diz respeito à quantidade e qualidade do DNA extraído. O segundo artigo demostrou que a ferramenta DNA Barcode é bastante eficiente para discriminar espécimes de peixes estuarinos amazônicos, em estágio de vida juvenil. Dos 46 haplótipos registrados, 70% apresentaram congruência entre a identificação morfológica e molecular, 22% demonstraram erros de identificação morfológica, enquanto 8% falharam na identificação, por falta de correspondência com os bancos públicos. Também nos alertou sobre os depósitos errôneos de sequências de DNA em bancos públicos, reafirmando a eficiência da combinação do DNA Barcode com a identificação morfológica tradicional, caracterizando uma abordagem integrativa, principalmente em casos de identificação morfológica controvérsia. O terceiro e o quarto artigo tiveram a família dos bagres marinhos, Ariidae, como objeto de estudo. O terceiro artigo abordou a produção de um protocolo forense, baseado em PCR multiplex para identificação, através de padrões de bandas, de produtos pesqueiros processados para sete espécies de Ariídeos, autenticando-os em menos tempo de processamento e de forma mais simples que o sequenciamento capilar. Por fim, o quarto artigo discutiu a diversidade de Ariidae da região costeira da Amazônia, comparando a identificação morfológica prévia com marcadores mitocondriais (COI e Cytb), com 92% da diversidade na região sendo amostrada. A identificação morfológica foi suportada por dados moleculares para a maioria dos táxons, como as espécies dos gêneros Sciades e Bagre. No entanto, mesmo apoiadas pela morfologia, as espécies Cathorops agassizii e Cathorops spixii apresentaram baixa divergência genética, enquanto Aspistor quadriscutis e Amphiarius phrygiatus formaram um único clado, indicando polimorfismo ancestral no DNA mitocondrial, com diversificação muito recente. Os resultados obtidos nesta tese contribuem para a aplicabilidade de genética molecular através do uso do DNA mitocondrial, para identificação e reconhecimento de espécies de peixes, além de gerar protocolo forense para autenticação de produtos pesqueiros.

  • JESSICA ALMEIDA DA SILVA
  • Avaliação da tolerância de rãs-touro sob baixas temperaturas: implicações para o bem-estar animal no transporte

  • Orientador : GALILEU CROVATTO VERAS
  • Data: 29/09/2023
  • Mostrar Resumo
  • O objetivo do trabalho foi avaliar dois manejos de transporte, um com rãs transportadas em caixas térmicas com gelo e outro em caixas vazadas de plástico e posteriormente a recuperação da homeostasia em quatro tempos após o transporte (0 h – imediatamente após o transporte, 6, 12, 24 h) e um tratamento de rãs em condição de homeostase (rãs na baia – grupo controle) para todos os tempos analisados. O experimento foi realizado em delineamento inteiramente casualizado em esquema fatorial (3x4) com 10 repetições (rã-touro). Os dados foram submetidos a Anova-two way para verificar a existência de interação entre os fatores (tempo x tratamento), ou ocorrência de efeito isolado de cada fator. A taxa de sobrevivência das rãs transportadas em caixas vazadas foi de 100% e as transportadas no gelo 90%.  Rãs do transportadas em gelo apresentaram aumento do peso corporal após o transporte e rãs transportadas em caixas vazadas diminuição. Rãs transportados nas caixas vazadas obtiveram elevação de ureia imediatamente após o transporte, havendo diminuição nos demais tempos.  O lactato manteve-se elevado após 24 horas em rãs transportadas em gelo e em caixas vazadas. O lactato nas rãs transportados em caixas vazadas e do grupo controle diminuiu 24 horas após o transporte.  Maiores níveis de triglicerídeos foi demonstrado nas rãs das caixas vazadas 24 horas após o transporte. Rãs transportas em gelo apresentaram colesterol total elevado imediatamente após o transporte, seguido de diminuição após 6 horas. Rãs transportadas em caixas vazadas apresentaram aumento de colesterol total imediatamente após o transporte, diminuição após 6 horas, seguido de aumento. Houve diminuição na quantidade de proteínas totais com o decorrer das horas, atingindo menores níveis 24 horas após o transporte. Houve diminuição na quantidade de eritrócitos nas rãs com decorrer do tempo, com menores valores nos tempos 12 e 24 horas de avaliação. Rãs transportadas em gelo e em caixas vazadas apresentaram diminuição na quantidade de eritrócitos em relação ao grupo controle. Rãs transportadas em gelo e em caixas vazadas apresentaram níveis de hematócrito mais baixos do que do grupo controle. Níveis de hemoglobina foram mais altos em todos as rãs no tempo 6 horas de avaliação e mais baixos 24 horas após o transporte. Rãs transportadas em gelo e em caixas vazadas apresentaram diminuição de hemoglobina em relação ao grupo controle. No transporte realizado em gelo houve elevação do VCM nas rãs após 12 e 24 horas. Rãs transportadas em gelo apresentaram concentração de hemoglobina corpuscular média (CHCM) semelhantes ao do grupo controle em todos os tempos de avaliação. Rãs transportadas em gelo mantiveram a CHCM similares até 12 horas após o transporte, diminuindo após 24 horas o. A CHCM das rãs transportadas em caixas vazadas aumentou 6 e 12 horas após o transporte e diminuíram 24 horas após o transporte. Rãs-touro transportadas em gelo apresentaram vários ajustes fisiológicos intrínsecos da espécie para enfretamento do frio durante o transporte, demandando energia para a manutenção de funções após o desafio imposto. O transporte em caixas vazadas promoveu estresse nas rãs-touro adensadas, conforme indicado pelas alterações dos parâmetros bioquímicos e do eritrograma analisados. É importante considerar a necessidade de aprimoramento nos dois manejos de transporte analisados como aclimatização prévia de rãs transportadas em baixa temperatura e uso de dispensadores e/ou outros objetos com água utilizados para o transporte de rãs em caixas vazadas sob temperatura ambiente, assegurando o bem-estar dos animais durante e após o transporte.

  • MARIANA JUCÁ MORAES
  • Efeito do sistema de integração lavoura-pecuária-floresta (ILPF) nas características comportamentais, fisiológicas e produtivas de bovinos de corte

  • Data: 25/09/2023
  • Mostrar Resumo
  • Na última década, diversas tecnologias e biotécnicas têm sido desenvolvidas e aplicadas para melhoria da produtividade, no controle zootécnico, na ambiência e no bem-estar dos animais de produção. Com elas, o sistema de integração lavoura-pecuária-floresta (ILPF) surge na intenção de trazer inúmeros benefícios aos animais, pois melhora os aspectos relacionados ao conforto térmico e proporciona uma menor incidência de radiação solar e permite temperaturas mais amenas nas pastagens. Por isso, o objetivo desse trabalho foi avaliar o efeito do sistema de ILPF no desempenho produtivo de machos bovinos jovens, visando melhorias na eficiência da produção a pasto e elevação do bem-estar animal no processo de produção. O experimento foi realizado na Embrapa Pecuária Sudeste, em São Carlos-SP, em dois sistemas de produção: Sistema a pleno sol (Grupo PS) e Sistema com arborização (Grupo ILPF). Foram utilizados 20 machos bovinos jovens da raça Nelore (Bos indicus) e 20 da raça Canchim (5/8 Bos taurus x 3/8 Bos indicus). Durante o experimento, o microclima das pastagens a pleno sol e em ILPF foi avaliado. As características de bem-estar animal, conforto térmico, ganho de peso e comportamento a pasto também foram monitoradas. As análises estatísticas foram realizadas considerando nível de significância de 5% (SAS, versão 9.4). Foi possível concluir que bovinos de diferentes genótipos apresentam comportamentos distintos em ambos os sistemas de produção estudados e que o sistema ILPF tornou o microclima do ambiente mais favorável, sendo eficaz para implantação principalmente em regiões de clima tropical.

  • CASSIANE AZEVEDO LEAL
  • Características morfológicas e minerais da casca do ovo no desenvolvimento embrionário de Kinosternon scorpioides

  • Data: 31/08/2023
  • Mostrar Resumo
  • Um dos principais entraves para produção de quelônios em cativeiro envolve a qualidade do ovo, pois a deficiência de cálcio afeta consideravelmente a sua produção. Compreender as demandas minerais necessárias para a formação óssea do embrião irá subsidiar melhores extratégias de manejo de Kinosternon scorpioides. O objetivo deste trabalho foi estudar a morfologia e a composição mineral dos ovos de K. scorpioides durante o período de incubação. Sendo observada a formação óssea no desenvolvimento embrionário, estabelecendo uma relação com a característica química e a estrutura da casca do ovo. Os ovos foram coletados, incubados e agrupados em três diferentes tratamentos: Pré-ossificação (PO), em ossificação (O) e Ossificação completa (OC), totalizando 24 amostras. A análise morfológica e mineral das cascas foi feita por Microscopia Eletrônica de Varredura, associada ao sistema de micro-análise de EDS. Na diafanização do embrião, a clarificação foi realizada através do KOH (6%) e a coloração de cartilagem e osso ocorreu por meio do Alcian Blue e Alizarina Red-S, respectivamente. Os resultados demonstraram que houve diferença significativa (p<0,05) na composição de cálcio da casca entre os tratamentos PO (63,15%) e OC (41,78%). Assim como na espessura da casca, entre os tratamentos PO (305,38 ± 60,27 µm) e OC (197,67 ± 40,28 µm) e entre O (289,56 ± 55,87 µm) e OC. Provavelmente, a mobilização gradual do cálcio pelo embrião refletiu na diminuição da espessura da casca. Além disso, as primeiras estruturas a ossificar foram o dentário e a maxila. O tratamento OC, onde os indivíduos apresentavam todas as estruturas ósseas estabelecidas, possuindo apenas fontanelas na carapaça e plastrão, demonstrou a menor concentração de cálcio. Aproximadamente 21% do cálcio da casca foi absorvido, indicando transferir quantidades substanciais para o embrião, viabilizando a mineralização óssea.

  • JULIANA CAROLINE DIAS PANTOJA
  • Investigação de microplástico em Crassostrea gasar durante atividade reprodutiva em estuários amazônicos

  • Data: 29/08/2023
  • Mostrar Resumo
  • Os manguezais são ecossistemas costeiros ricos em biodiversidade, que fornecem abrigo e alimentação para a fauna que vive nesses ambientes. A abundância de recurso torna o local propício para implementação de atividades aquícolas de criação de animais, onde destacamos a malacocultura. Na região amazônica Crassostrea gasar, conhecido como ostra do mangue, destaca-se entre os cultivos em ambiente estuarino por apresentar desempenho satisfatório, atingir maiores tamanhos e possuir melhor capacidade reprodutiva frente as variações de salinidade. Infelizmente, esses ecossistemas estão enfrentando ameaças crescentes como a poluição por microplásticos. Os microplásticos são pequenas partículas de plástico com menos de 5 milímetros de tamanho, muitas vezes resultantes da degradação de plásticos maiores ou de produtos de higiene pessoal, como esfoliantes faciais ou cremes dentais. O presente estudo teve como objetivo investigar a presença de microplástico em Crassostrea gasar durante atividade reprodutiva no estuário amazônico. No capítulo I foi investigado a incidência/abundância de microplásticos em C. gasar durante atividade reprodutiva, foi relatado a abundância de microplásticos em dois formatos (fibras e fragmentos), de diferentes cores (azul, preto, transparente e vermelho), nas ostras de 4 áreas de cultivo. A concentração de microplástico foi maior em ostras cultivadas em áreas com grande fluxo de atividade antrópica. No capítulo II foi verificado a presença de microplásticos durante as distintas fases de vida da C. gasar (sementes, juvenis e adultas), acreditamos que animais adultos podem apresentar maior concentração de microplástico, sendo assim, as partículas de micropláticos uma vez ingeridas podem acumular e causar danos ao sistema digestivo, bem como ao reprodutivo. Em relação à reprodução, no capítulo III, C. gasar apresentou atividade reprodutiva desde a fase semente com ciclo de maturação gonadal completo em ambos os sexos. Contudo, observamos que há presença maior de células em atresia e de gametas residuais nos estádios de desova/espermiado nas sementes de ostras, comparados com os estágios de vida. Em continuação, o capítulo IV foi realizada a caracterização estrutural e ultraestrutural da espermatogênese da espécie, foi verificado que há conservação da morfologia das células da espermatogênese ou  como a presença das vesículas pró-acrossomais em espermatogônias B, espermatozoide e flagelo longo. Assim como houve diferenças na quantidade de mitocôndrias na peça intermediária nas espécies do gênero. A condição ambiental das áreas onde esses animais são cultivados é essencial, pois fatores extrínsecos (salinidade, pH, oxigênio e poluição) e fatores intrínsecos (hormônios) influenciam na reprodução e nos demais processos fisiológicos do animal. A questão dos microplásticos na cadeia alimentar é um desafio global e requer ações para reduzir a produção e o uso de plásticos descartáveis, bem como melhorar a gestão de resíduos para evitar que essas partículas cheguem aos corpos hídricos. Além disso, é importante haver um monitoramento das áreas de cultivo, e políticas públicas para  a gestão dos microplásticos nos manguezais e desenvolver estratégias eficazes de mitigação.

  • BRUNO PORPINO HOMOBONO
  • EFEITO DO FLUIDO FOLICULAR NA FECUNDAÇÃO IN VITRO

  • Data: 25/08/2023
  • Mostrar Resumo
  • A produção in vitro de embriões (PIVE) e outras tecnologias de reprodução assistida são importantes ferramentas no aumento da produtividade dentro da pecuária, porém esta biotecnologia apresenta uma baixa eficiência devido as condições in vitro serem diferentes das encontradas in vivo. Particularmente na etapa de fecundação in vitro (FIV), a manipulação dos gametas gera estresses oxidativos que podem prejudicar o posterior desenvolvimento do embrião. Na natureza a fecundação ocorre na presença de fluido folicular (FF), um fluido biológico derivado do plasma sanguíneo que estimula o processo de capacitação do oócito e dos espermatozoides. Em vista disso, este trabalho irá utilizar diferentes concentrações de FF como suplemento em meios de FIV com o objetivo de avaliar se a presença de FF é viável para a FIV e se este irá afetar a formação de blastocistos no processo de produção in vitro de embriões bovinos.  As amostras de CCOs bovinos serão fecundados em diferentes grupos experimentais: Grupo 1 (meio controle, sem a adição de FF); Grupo 2 (meio de FIV suplementado com 5% de FF); e Grupo 3 (meio de FIV suplementado com 10% de FF). Após a fecundação, os presumidos zigotos dos diferentes grupos serão cultivados e depois avaliados referente a suas taxas de clivagem e taxas de formação de embriões. A qualidade dos embriões obtidos nestes processos será avaliada através de genes marcadores de qualidade embrionária amplificados por reação em cadeia de polimerase em tempo real. É esperado que a partir dos resultados seja possível observar a viabilidade do uso de FF como suplemento na FIV, assim como um aumento na quantidade e qualidade de embriões produzidos.

  • ARLINDO DOS SANTOS PINHEIRO JUNIOR
  • FARINHA DE INSETO (Nauphoeta cinérea) EM SUBSTITUIÇÃO À FARINHA DE PEIXE EM DIETAS PARA JUVENIS DO PEIXE ORNAMENTAL AMAZÔNICO Pyrrhulina brevis

  • Data: 17/08/2023
  • Mostrar Resumo
  • Avaliar o uso de ingredientes alternativos para dietas de peixes é crucial para a sustentabilidade da aquicultura. A produção de farinhas de peixe impacta os recursos marinhos, tornando importante considerar outras opções. As farinhas de inseto surgem como uma alternativa promissora, pois apresentam níveis de proteína semelhantes à farinha de peixe e perfil de aminoácidos equilibrado. Entre os peixes ornamentais amazônicos, a Pyrrhulina brevis é valorizada na aquariofilia por seu comportamento pacífico e cores intensas, especialmente durante o período reprodutivo. Assim, com o presente estudo objetiva-se avaliar os efeitos da inclusão de farinha de inseto (Nauphoeta cinérea) em substituição à farinha de peixe em dietas para juvenis de P. brevis. Foram utilizados 300 juvenis de P. brevis, (0,21 ± 0,01g e 2,37 ± 0,22cm), distribuídos aleatoriamente em 15 aquários cônicos (30L de água), na densidade de 20 peixes aquário-1. Todos os aquários eram dotados de sistema de aeração individual e sistema de coleta de fezes por decantação. O experimento foi conduzido em delineamento inteiramente casualizado, com cinco tratamentos e três repetições. Os peixes foram alimentados com as dietas experimentais contendo 0, 5, 10, 15 e 20% de inclusão de farinha de inseto, valores correspondentes a 0, 25, 50, 75 e 100% de substituição da farinha de peixe pela farinha de inseto, por 80 dias, na frequência alimentar de quatro vezes ao dia. As coletas de fezes foram realizadas diariamente, antes da primeira alimentação. Ao final do experimento, os peixes foram pesados, medidos e contados para a determinação dos parâmetros de desempenho produtivo e digestibilidade da matéria seca, proteína bruta e quitina das dietas. Em seguida, os peixes foram eutanasiados para determinação da composição corporal e análise da microbiota intestinal. Os peixes alimentados com a dieta contendo 15% de farinha de inseto apresentaram melhores resultados para os parâmetros de comprimento. Os maiores valores de deposição de proteína foram observados nos peixes alimentados com as dietas contendo 15% e 20% de inclusão. Os juvenis alimentados com a dieta sem farinha de inseto tiveram melhor coeficiente de digestibilidade aparente para proteína. Os peixes alimentados com 15% e 20% de farinha de inseto apresentaram melhor coeficiente de digestibilidade aparente para a matéria seca e a quitina, respectivamente. A contagem de bactérias intestinais foi mais alta nos peixes que receberam dietas com maior inclusão de farinha de inseto. Conclui-se que a farinha de inseto pode ser utilizada como fonte proteica alternativa para substituir parcialmente a farinha de peixe em dietas para P. brevi.

  • ANA PAULA SANTOS SILVA
  • DESENVOLVIMENTO LARVAL E ONTOGENIA DO SISTEMA DIGESTÓRIO DA LARVA DE ACARÁ SEVERO Heros severus (HECKEL, 1840)

  • Orientador : ROSSINEIDE MARTINS DA ROCHA
  • Data: 14/08/2023
  • Mostrar Resumo
  • Peixes ornamentais vêm despertando um grande interesse em aquaristas de todo o mundo. Dentre a diversidade de ornamentais nativos da Amazônia, o acará severo (Heros severus), apresenta um potencial promissor para a piscicultura ornamental devido a sua exuberância e coloração dos espécimes. Assim como entre outras espécies nativas, há uma escassez de informações na literatura quanto ao seu desenvolvimento inicial. Então o presente trabalho tem como objetivo caracterizar os estágios larvais e descrever o desenvolvimento do sistema digestório da espécie acará severo. O cultivo foi realizado no Laboratório de Piscicultura, situado no campus Bragança. Após a reprodução as larvas foram coletadas em um intervalo de tempo e foram realizadas análises morfométricas. Posteriormente foi realizado o processamento histológico. As larvas eclodiram 72 horas após a fecundação, com um comprimento padrão médio de 4,58mm, a uma temperatura média de 29ºC. Um total de 89 larvas foram analisadas com o comprimento padrão variando de 4,58 a 8,03mm. As larvas de H. severus exibiram maior taxa de desenvolvimento do 4º ao 9º dpf, com o comprimento corporal de 5,30 a 6,70 mm. Após a eclosão, o sistema digestório de H. severus consistiu de um tubo reto deitado dorsalmente sobre o saco vitelino, o fígado bem desenvolvido com aspecto de uma massa lobular correndo ao longo de toda a cavidade abdominal quase até o poro anal. Foi observado o pâncreas exócrino e diferenciado em larvas a partir do 14º dpf. O presente estudo revelou um período longo de depleção do saco vitelino em relação a outros ciclídeos. Essas informações contribuem para subsidiar o manejo da larvicultura e conservação desta espécie.

  • JANIELI DO SOCORRO AMORIM DA LUZ SOUSA
  • CARACTERIZAÇÃO In Silico DE GENES ENVOLVIDOS NA DIGESTÃO DE FIBRAS VEGETAIS DO CAMARÃO-DA-AMAZÔNIA


  • Data: 04/08/2023
  • Mostrar Resumo
  • Foram minerados e caracterizados genes imputados a digestão de fibras vegetais no genoma funcional do camarão-da-amazônia. Foi realizada uma análise in sílico, a partir do pareamento e anotação entre os bancos de dados do transcriptoma do hepatopâncreas e o CAZy (Carbohydrate-Active enzymes Database). Dos ~3800 genes que apresentaram expressão diferencial no hepatopâncreas (≠ músculo), 1.116 sequências foram atribuídas a digestão de carboidratos, dentre as quais foram anotados 178 fragmentos classificados como Glicosil Hidrolases. Para a digestão das fibras vegetais foram registrados 18 fragmentos imputadoas a celulases e 56 para as hemicelulases. Apenas uma enzima foi registrada para a digestão da celulose: endo-β-1,4-glucanase. Para digestão da hemicelulose foram encontradas sete enzimas: α-mannosidase, β-mannosidase, β-galactosidase, mannan endo-1,4-β-mannosidase, β-glucuronidase, α-L-fucosidase e Lysosomal acid glucosylceramidase. Todos os genes minerados possuíram regiões codificantes completas, domínios e sítios ativos característicos conservados ou semiconservados, além do compartilhamento de homologia com outros crustáceos. Esses achados são um indicativo  que a espécie pode aproveitar fibra vegetal como fonte de energia,  podendo ser utilizadas para nortear ensaios de nutrição. O uso de fibras vegetais na dieta do camarão-da-amazônia pode aumentar a sustentabilidade econômica do cultivo, pois as fibras vegetais são os ingredientes mais baratos e abundantes do planeta.

  • ADRIEL BEHN DE BRITO
  • Vitrificação e cultivo in vitro em fragmento de córtex ovariano de Sapajus apella (Linnaeus, 1758): Efeitos dos dispositivos “ovarian tissue cryosystem (OTC)” e do emprego de antioxidantes e reguladores de estresse osmótico

  • Orientador : SHEYLA FARHAYLDES SOUZA DOMINGUES
  • Data: 10/07/2023
  • Mostrar Resumo
  • SourceURL:file:///home/Sheyla/Documentos/ORIENTANDOS/Tese Adriel 20-06-2023.doc

    Os objetivos desse trabalho foram (1) comparar a utilização de Ovarian tissue cryopreservation (OTC) e de palhetas como métodos de vitrificação; (2) avaliar o efeito do cultivo in vitro de tecido ovariano vitrificado em um meio adicionado ou não de betaína ou Salubrinal, reguladores de estresse osmótico, e (3) avaliar o efeito do estresse causado pelo cultivo in vitro e pela vitrificação sobre a expressão de fatores angiogênicos VEGF e Cd31 (PECAM1). Logo, foram realizados dois experimentos: Experimento I - de cada ovário de 5 fêmeas, 1 biopsia ovariana foi coletada e dividida em 12 fragmentos de 1,5 mm³ (1 mm de altura x 1 mm de largura x 1,5 mm de comprimento). Três fragmentos foram escolhidos aleatoriamente e destinado para histologia clássica (HC) e IHC. Estes fragmentos constituíram o Grupo Controle a fresco. Os demais fragmentos foram vitrificados de acordo com o protocolo do OTC denominado de Tratamento I (Vitrificação em OTC – MEM + 10 mg/mL BSA + 0,25 M de sacarose + 20% de etilenoglicol  e 20% de dimetilsulfóxido); palheta utilizando o protocolo modificado, vitrificação em palheta no lugar de OTC, denominado de Tratamento II (Vitrificação em Palheta de 0,5 ml – MEM + 10 mg/mL BSA + 0,25 M de sacarose + 20% de etilenoglicol  e 20% de dimetilsulfóxido) e Kawamura et al. (2013), denominado de Tratamento III (Vitrificação em Palheta de 0,5 ml – Meio H199 + 20% de SSS + 5,64 M (31,5%) de etilenoglicol + 5% PVP + 0,5 M de sacarose).  Experimento II - fragmentos do córtex ovariano de fêmea de Sapajus Apella, com tamanho igual ao descrito no tratamento I, foram vitrificados utilizando os dois melhores tratamentos das Fases I ou imediatamente cultivados in vitro com diferentes concentrações de betaína (0 e 0,01%) ou Salubrinal (0 nM e 100 nM). O tecido vitrificado também foi posteriormente cultivado in vitro com betaína e salubrinal, conforme descrito acima: Resultados: na avaliação da distribuição percentual média dos folículos pré-antrais do tecido a fresco, foi observado que os folículos primordiais (48±8%), foram encontrados em maior quantidade, seguido por folículos de transição (23±4%) e primários (21±3%). Como esperado, a população de folículos secundários (8±4%) foi observada em menor quantidade. Na comparação entre os três métodos de vitrificação testados e o controle, em relação ao percentual médio dos folículos normais, foi observado que a porcentagem de folículos normais só foi mantida similar ao controle (85,6 ± 4,4) no Tratamento II (77,9 ± 3,4), mesmo obtendo bons percentuais de folículo normais no Tratamento I (74,5 ± 1,9) e no Tratamento III (70,8 ± 4,5). Desta forma, no presente estudo, foi possível realizar a caracterização da morfologia, morfometria e expressão de fatores angiogênicos em folículos pré-antrais normais e atrésicos de Sapajus apella. Esta descrição pode apoiar a análise da qualidade folicular e sobrevida após procedimentos como transplante e criopreservação.  Também foram obtidos percentuais de folículos normais, no tecido do córtex ovariano após vitrificação, aquecimento e cultivo, em percentuais similares aos encontrados imediatamente após a vitrificação e aquecimento, demostrando as técnicas realizadas foram eficientes e promissoras.

  • JULIANE DA SILVA COSTA
  • SISTEMAS DE PRODUÇÃO E MERCADO DE PATOS DOMÉSTICOS NO ESTADO DO PARÁ

  • Data: 30/06/2023
  • Mostrar Resumo
  • O maior conhecimento sobre as características da carne de pato possibilita implementar iniciativas que visam promover o seu maior consumo per capita e uma valiosa ferramenta para um posicionamento estratégico dos ofertantes é a identificação das principais características e desejos do mercado-alvo, direcionando a produção e consolidando o sistema de produção. Objetivou-se sistematizar informações sobre a qualidade nutricional da carne de pato a fim de conhecer o principal produto da ansericultura no estado do Pará, Amazônia brasileira, além de descrever os principais atores desta cadeia produtiva: produtores, mercado varejista e consumidores, visando identificar as potencialidades e as limitações da atividade no âmbito regional. Este estudo caracterizou-se como exploratório e descritivo com abordagem quantitativa e utilização de técnicas estatísticas para as análises dos dados, onde, através das entrevistas pessoais, empregou-se a aplicação de questionário semiestruturado para a coleta de dados primários. Os resultados mostraram que a carne da espécie Cairina moschata pode ser considerada como uma alternativa para as carnes de mamíferos e de outras aves do ponto de vista nutricional. A maioria das propriedades rurais observadas pratica a produção avícola de subsistência e de forma tradicional, caracterizada por ser de pequenas áreas e seus produtores possuírem pouco acesso à tecnologia, sendo o sistema de criação extensivo o mais adotado. O maior custo na produção de patos domésticos é com a alimentação das aves, sendo este o principal motivo que leva a desistência da atividade. Por meio da análise de cluster, o mercado consumidor total de carne de pato do município de Belém se divide em três segmentos quanto ao perfil dos consumidores, os tradicionais (homens idosos de baixa renda), os jovens (mulheres jovens de baixa renda) e os de meia idade (mulheres maduras de baixa renda). A demanda por carne de pato é sazonal e é estimulada por fatores socioculturais e demográficos, já a oferta varejista é regular durante todo o ano, tanto nas feiras livres quanto no setor supermercadista. Os fatores socioeconômicos se mostraram os principais determinantes para a quantidade ofertada, diversificação de produtos e preço praticado na capital paraense. Sugere-se para os estudos futuros, ampliar o conhecimento sobre as características da produção de patos domésticos na Amazônia e do mercado da carne de pato no estado do Pará, a fim de melhor orientar o sistema de produção e o setor varejista, objetivando desta forma consolidar a cadeia produtiva na região, assim como a implantação de ações de marketing para divulgar as características benéficas da carne visando a fidelização do mercado e o alcance de consumidores potenciais.

  • ANDRÉA DO NASCIMENTO BARRETO
  • Comportamento e fisiologia de bovinos de corte de diferentes grupos genéticos criados em pastagens a pleno sol ou arborizadas

  • Data: 28/04/2023
  • Mostrar Resumo
  • A utilização de sistemas de pastagens com arborização tem sido sugerida como alternativa para o desenvolvimento de sistemas de produção mais sustentáveis e para oferecer maior conforto térmico aos animais criados em áreas de clima tropical. O trabalho de tese foi dividido em dois artigos. O primeiro artigo é intitulado “Conforto térmico e comportamento de bovinos de corte em pastagens de sistemas baseados em pastagem monitorada por observação visual e por dispositivo eletrônico” objetivou estudar o efeito da incorporação do componente arbóreo em sistemas de produção a pasto em ambiente tropical sobre o conforto térmico e analisar a influência do sistema de integração lavoura-pecuária-floresta no comportamento de bovinos de corte, em diferentes estações climáticas. O segundo artigo é intitulado “Características adaptativas tegumentares de bovinos de corte criados em pastagens de ambiente tropical”, e objetivou estudar a dinâmica de atributos morfológicos e funcionais do pelame e da pele de bovinos Nelore e Canchim criados a pasto, durante as estações climáticas de maior contraste térmico, as quais podem influenciar na termotolerância dos animais. O estudo gerou informações importantes sobre as resposta comportamentais e fisiológicas de bovino de corte criados em pastagens com uso de diferentes tecnologias, como forma de ampliar o entendimento de sua capacidade termorregulatória e embasar as tomadas de decisão referentes a práticas de manejo de bovinos de corte.

  • FRANCISCO ALEX LIMA BARROS
  • USO DE BACTÉRIA AUTÓCTONE COM POTENCIAL PROBIÓTICO ENRIQUECIDO NO ALIMENTO VIVO NA LARVICULTURA DO PIAUÇU Megaleporinus macrocephalus

  • Data: 17/04/2023
  • Mostrar Resumo
  • A atividade aquícola tem se intensificado cada vez mais, em contrapartida, uma série de problemáticas como os surtos de bacterioses, são cada vez mais imprevisíveis e acabam surgindo, surgindo nos sistemas de criação. Como remediação, o uso por vezes negligente de antibióticos, estimulam a seleção de genes de resistência dos microrganismos à estes fármacos. Assim, surge a necessidade do desenvolvimento de técnicas produtivas mais sustentáveis na aquicultura, afim de dispor de opções terapêuticas eficazes para reduzir as perdas em massa na criação de diversas espécies. Entre elas, o piauçu Megaleporinus macrcephalus, se destaca entre as espécies nativas, que é muito apreciada e tem grandes perspectivas produtivas. Como alternativa, os probióticos são usados para incrementar o desempenho produtivo, melhorar a qualidade sanitária e imunológica dos animais. São microrganismos vivos capazes melhorar a conversão de nutrientes da dieta, melhoram o equilíbrio da microbiota intestinal e ajudam na prevenção de doenças através da modulação do sistema imune do hospedeiro. Assim, a pesquisa objetivou isolar, selecionar in vitro bactérias autóctones do intestino de M. macrcephalus e avaliar o seu efeito, nas fases iniciais de desenvolvimento da espécie, sobre o desempenho do crescimento, modulação da microbiota e morfologia intestinal, além da resistência contra bactérias patogênicas. O estudo foi conduzido em duas etapas: a primeira em isolar e selecionar a cepa com potencial probiótico por testes in vitro. Para tanto, as cepas foram selecionadas do trato intestinal de 15 espécimes saudáveis e inoculadas em placas de Petri contendo Man Rogosa Sharped Agar (MRS), por 48 horas, a 35 ºC. Para o isolamento foram utilizados testes de catalase, coloração de Gram, tolerância a diferentes gradientes de NaCl (1, 2 e 3%), diferentes valores de pH (4, 5, 6, 8 e 9) e sais biliares (2,5 e 5%), além do halo de inibição contra bactérias patogênicas Aeromonas hidrophila, Aeromonas caviae, Aeromonas jandaei, Pseudomonas aeroginosa, Streptococcus agalactiae. Para a identificação das cepas isoladas, foi utilizado o método de espectofotometria de massa de MALDI-TOF-MS. Todos os testes foram realizados em delineamento inteiramente casualizado, com 4 repetições. Para os testes in vivo, náplios de Artemia sp. enriquecidas com probiótico autóctone Enterococcus faecium, pelo método de imersão durante 40 min, logo após foram ministradas em quatro tratamentos (C: sem probióticos; T1: 1,0 x 104; T2: 1,0 x 106 e T3: 1,0 x 108 UFC.mL-1) foram utilizados, em quadruplicata. As larvas (n=160; peso = 5,3 ± 2,3 mg e comprimento = 3,73 ± 0,4 mm) foram distribuídas em recipientes de 16 L na densidade de 10 larvas.L-1 durante 20 dias. Além disso, simultaneamente, outro experimento foi constituído de seis tratamentos, conduzido em delineamento inteiramente ao acaso, em esquema fatorial 3 x 2, composto por três frequências de alimentação (2x, 3x e 4x.dia) e duas dietas (I sem probiótico) e (II com probiótico), em cinco repetições, fornecidos via alimento vivo enriquecidas com probióticos, pelo mesmo método de enriquecimento do experimento anterior.  As larvas (n= 300; peso = 5,2 ± 2,6 mg e comprimento = 3,69 ± 0,4 mm) foram distribuídas em 30 recipientes de 1 L na densidade de 10 larvas.L-1. Após o período de experimentação, o desempenho produtivo, a sobrevivência, a microbiologia e histomorfometria intestinal foram medidos, além do desafio agudo contra a bactéria patogênica Aeromonas hydrophila. Os resultados apresentaram 42 cepas isoladas no experimento in vitro, com destaque para as cepas ST1 e ST9 que apresentaram maiores valores (P<0,05) para células viáveis totais (31,80 ± 0,07 e 32,51 ± 0,05 UFC/mL × 108), respectivamente. Nos testes de resistência, as cepas ST1 e ST9 apresentaram os melhores resultados, com destaque para ST9 em altos gradientes de pH, altos valores de sais biliares (2,5 e 5%), além dos maiores halos de inibição (19,40 ± 0,99 e 19,08 ± 0,79), contra Aeromonas hydrophila e Aeromonas jandaei, respectivamente. As cepas com melhores resultados nos testes, ST1 e ST9, foram identificadas pelo método de MALDI-TOF-MS como Enterococcus faecium (20218_1 CHB). Para os testes in vivo, a suplementação com 1,0 x 108 UFC.mL-1 promoveu maior ganho de comprimento (13,78 ± 0,40 cm) e peso total (0,08 ± 0,002 g), maior contagem de bactérias lácticas, menor de heterotróficos totais nos intestinos e maiores vilosidades intestinais. As dietas contendo probióticos influenciaram na resistência dos animais à infecção aguda, com menor mortalidade acumulada em T3 e maior em C+. Os resultados das frequências de alimentação mostraram interação significativa (p<0,05), com as maiores médias de ganho de comprimento e peso total para as frequências de 3 e 4x.dia (dieta II) suplementadas com probiótico, maiores contagens de bactérias ácido láticas na dieta II e maior contagem de bactérias heterotróficas totais na dieta I, nos intestinos. As dietas contendo probióticos influenciaram a resistência dos animais na infecção aguda, com menor mortalidade acumulada no grupo 4x.dia – dieta II, ao contrário do C+. Assim, a bactéria isolada E. faecium, isolada do trato intestinal do piauçu pode ser recomendada para uso probiótico na criação do M. macrocephalus na concentração (1,0 x 108 UFC.mL-1). A suplementação via alimento vivo é uma alterativa de inclusão de vários produtos e substancia na larvicultura, em especial, o probiótico promoveu melhoria no desempenho de crescimento, na modulação da microbiota intestinal e nas vilosidades do intestino e, maior resistência frente a bactéria patogênica. Além disso, a suplementação probiótica com a bactéria autóctone, nas frequências de 3 e 4x.dia também proporcionam melhora zootécnica, modulação da microbiota dos peixes e maior sobrevivência na infecção aguda contra A. hydrophila

  • NAUARA MOURA LAGE FILHO
  • Impactos da mudança de uso da terra na Amazônia sobre a emissão de gases de efeito estufa em sistemas agropecuários

  • Data: 16/02/2023
  • Mostrar Resumo
  • O óxido nitroso (N2O) e metano (CH4) estão entre os principais gases causadores de efeito estufa emitidos pelo solo. As mudanças no uso da terra na Amazônia podem alterar os padrões de emissão desses gases, uma vez que alteram a composição botânica, o ecossistema e a comunidade microbiológica do solo. Objetivou-se com o presente estudo avaliar os efeitos do uso da terra, temperatura e nitrogênio sobre as emissões de N2O e CH4 em solos na Amazônia. Para isso, foram conduzidos dois ensaios, sendo o primeiro para avaliar os impactos da mudança no uso da terra e demais fatores supracitados sobre a emissão de N2O e o segundo ensaio sobre as emissões de CH4. Foram realizadas três incubações de solo, com cinco repetições, para quantificar as emissões de cada gás em: (i) três diferentes usos da terra (floresta úmida, pastagem e agricultura); (ii) diferentes temperaturas (25; 30; 35 e 40 °C); e, (iii) diferentes doses de nitrogênio ao solo (0; 90; 180 e 270 kg de N ha−1). O uso da terra altera o fluxo de N2O (P<0,01), com maiores emissões observadas em solos agrícolas em comparação com áreas de floresta e pastagem. Solos mantidos a 30 °C aumentaram as emissões de N2O com o uso da terra, onde emissão foi maior nos solos de pastagem e agricultura. Nossos resultados direcionam que a emissão de N2O no solo da floresta amazônica foi baixa independentemente da temperatura e da dose de nitrogênio. Ao se observar as emissões de CH4 em relação à mudança de uso da terra, é visto que os solos de pastagem tendem a emitir maior concentração de metano para a atmosfera (P<0,01). Independentemente da temperatura estudada, os solos de pastagem tenderam a apresentar maiores emissões de CH4 que os demais solos (P<0,05), e foi o único que sofreu variação com o aumento das temperaturas, uma vez que a temperatura de 25 °C, apresentou maior emissão. A dose de nitrogênio aplicada no solo também afetou o padrão de emissão de CH4 em todos os solos, sendo que as maiores emissões continuaram sendo observadas em solos de pastagem (P<0,05). Portanto, a mudança no uso da terra e fatores edafoclimáticos (temperatura e nutrientes) tendem a alterar a resiliência do ecossistema após a conversão de floresta para um sistema de produção, proporcionando emissões maiores emissões de N2O ou CH4.

  • MANOEL ALESSANDRO BORGES DE AVIZ
  • POSPECÇÃO DE GENES ASSOCIADOS AO CRECIMENTO E METABOLISMO EM Macrobrachium amazonicum (Heller, 1862)


  • Data: 07/02/2023
  • Mostrar Resumo
  • Foi obtido o genoma funcional do Macrobrachium amazonicum para determinar os genes diferencialmente expressos por tecidos e morfotipos, com ênfase naqueles imputados ao metabolismo e ao crescimento. Foram analisados o hepatopâncreas, músculo e aparelho reprodutor masculino. O software WEGO foi utilizado para minerar os genes com função de digestão de proteínas e lipídios, no banco de sequências do hepatopâncreas. De um total de 7.844 sequências diferencialmente expressas, 2.910 foram anotadas com termos obtidos no banco de dados do Gene Ontology (GO). Após remoção das sequências repetidas, restaram 77 sequências anotadas como enzimas de digestão de proteínas, distribuídas entre as classes das serinas (24 transcritos), cisteína (51 transcritos) e aspártil peptidases (2 transcritos). Entre os unigenes anotados, foram registrados genes associados ao metabolismo geral de lipídeos (494 fragmentos), metabolismo celular de lipídeos (359 fragmentos) e transporte de lipídeo (31 fragmentos). Também foram identificadas seis vias metabólicas enriquecidas a partir das enzimas expressas, como biossíntese de ácidos graxos, metabolismo de esfingolipídeo, biossíntese de esteroide, degradação de ácido graxos, metabolismo de glicerol lipídeo e elongação de ácidos graxos. Entre os fragmentos atribuídos a digestão e metabolismo de lipídios, os mais importantes foram selecionados para caracterização: low density lipoprotein receptor e pancreatic triacylglycerol lipase. Outros 2 fragmentos não expressos diferencialmente, também foram incluídos nas caracterizações, devido a sua importância para manejos nutricionais futuros: delta_4_desaturase e fator de elongação de ácidos graxos de cadeia longa. Também foram caracterizados os genes com atribuições de crescimento: hormônio hiperglicêmico de crustáceos (CHH), farnesoic acid O-methyltransferase (FAMeT), miostatina (MSTN), receptor de ecdisona (EcR), mecanismo alvo da rapamicina (mTOR) e o fator de regulação miogênico (MRF). Todos os transcritos atribuídos a função de crescimento são associados à muda e/ou processos fisiológicos de crescimento muscular. As análises indicam alta similaridade entre as cadeias de aminoácidos dos principais domínios característicos dos genes selecionados, em comparação com seus homólogos já descritos em outras espécies de crustáceos. Os resultados obtidos podem ser utilizados em estudos futuros para auxiliar no desenvolvimento de marcadores com uso em experimentos de crescimento e nutrição.

2022
Descrição
  • GEISSY HELEN DE SOUSA
  • CALAGEM E GESSAGEM PARA MANUTENÇÃO DE PASTAGENS DE Panicum maximum cv. MASSAI

  • Data: 20/12/2022
  • Mostrar Resumo
  • O presente trabalho teve por objetivo avaliar o efeito da calagem e gessagem superficial em pastos formados sobre a fertilidade do solo e a produtividade do capim Panicum maximum cv. Massai. Foi utilizado um delineamento em blocos casualizados (DBC) com quatro tratamentos e cinco repetições, totalizando 20 unidades experimentais de 12 m2. O capim Massai utilizado no estudo foi implantado no ano de 2014, foram realizadas quatro coletas de solo na área em três profundidades 0-10, 10-20, 20-40 cm, essas análises de fertilidade ocorreram uma no início para caracterizar o solo, uma 45 dias após a correção, uma no final da primeira estação chuvosa e uma no final do experimento, tendo o experimento à duração de um ano. As coletas de produtividade ocorreram toda vez que o capim atingiu a altura de 50 cm, sendo a altura do resíduo de 25 cm, uma parte do material coletado era destinado para análise da composição química e outra para a realização da separação morfológica. A coleta de raiz para a avaliação da quantidade e densidade de raiz por profundidade ocorreu ao final do primeiro ano de avaliação. Os dados foram organizados em planilhas no programa microsoft excel 2019®, e submetidos à análise de variância e ao teste de tukey, para comparação de médias, a 5% de probabilidade, todos utilizando o programa estatístico SAS®. No período de 45 dias após a aplicação dos corretivos no solo não foi observada interação (p valor menor que 0,05) para tratamento corretivo e profundidade. Para as coletas realizadas ao final do período chuvoso e final do experimento foram observadas interação (p valor menor que 0,05) entre os corretivos e as profundidades para as variáveis pH em água, cálcio (Ca), magnésio (Mg), Alumínio (Al), soma de bases (SB), saturação de bases (V%), saturação por alumínio (m%) e acidez potencial (H+Al) somente para a análise do final do experimento. As profundidades não interferiram no efeito dos corretivos no período de 45 dias após a aplicação. O uso do gesso não altera a acidez ativa (pH) do solo, o uso do Optmix se equivale ao uso do calcário puro.  Calcário e optmix foram mais eficientes na elevação do pH, na redução dos teores de alumínio, acides potencial, saturação por alumínio e, na elevação dos teores de Ca, Mg e saturação por bases na camada de 0 – 10 cm. Os corretivos não influenciaram na quantidade e densidade de raiz, produtividade, composição química e separação morfológica do capim Massai.

  • DANYELLI DE OLIVEIRA AMANAJÁS
  • Extração de descritores de forma de bovinos a partir de imagens de RPA (Aeronave Remotamente Pilotada) com implementação do Mask R-CNN

  • Data: 05/10/2022
  • Mostrar Resumo
  • Objetivou-se com esse estudo, extrair descritores de forma de bovinos com base em visão computacional a partir do imageamento por Aeronave Remotamente Pilotada (RPA), com a implementação de um algoritmo de reconhecimento, detecção e segmentação (Mask R-CNN) de objetos em uma imagem. Deste modo, registrou-se vídeos por PRA de 5 a 10 minutos de duração, de 125 fêmeas F1 Angus-Nelore em fase final de terminação, em dois ambientes de criação e em três alturas de sobrevoo (8, 10 e 15m). De posse dos imageamentos, a fim de atender o pré-requisito de entrada de imagens do algoritmo Mask R-CNN, procedeu-se com a extração dos frames (1088 x 1088 pixels), obtendo 1.045 imagens. Ainda sobre estas, foi aplicada a técnica Data Augmentation (DA) por meio do efeito de deslocamento de altura por aproximação (+Zoom), para avaliar os intervalos entre as três alturas de sobrevoo, compondo assim o banco de dados Database Augmentation (DAU) analisado neste estudo, totalizando 1.339 imagens. Este banco foi fracionado em treinamento e teste, obedecendo uma proporção de 70:30, respectivamente. Foram compostos modelos com até 200 épocas e uma arquitetura backbone do Mask R-CNN (ResNet101), tais modelos foram avaliados sob as métricas Loss, Val_Loss e mAP (%). O Database Augmentation mostrou altas precisões, com melhor desempenho para a época 35, com mAP de 96,08%, Loss de 0,2296 e Val_Loss de 0,4888. A partir deste modelo ser selecionado se procedeu com a extração dos descritores de forma para cada objeto (bovino) nas imagens do cenário de confinamento a partir das máscaras extraídas pelo Mask R-CNN. A implementação proposta se mostrou capaz de extrair descritores de forma dos bovinos nas imagens de RPA, permitindo uma futura abordagem para a predição do peso corporal desses animais.

  • KAYAN DA CUNHA ROSSY
  • VIDEOCIRURGIA E VITRIFICAÇÃO COMO RECURSOS PARA COLETA, CONSERVAÇÃO E AUTOTRANSPLANTE DE TECIDO OVARIANO PARA MANUTENÇÃO DE FERTILIDADE EM BOVINOS E BUBALINOS

  • Orientador : PEDRO PAULO MAIA TEIXEIRA
  • Data: 31/08/2022
  • Mostrar Resumo
  • Tendo em vista que muitas biotecnologias de conservação são onerosas ou de difícil acesso/transporte, na etapa 1 deste trabalho objetivou avaliar por quanto tempo preserva-se a viabilidade das células gametogenicas recuperadas de tecido ovariano criopreservados em geladeira. Para isso, foram coletados aproximadamente 80 ovários de bovinos hígidos, divididos em diferentes grupos de estudo e armazenados sob refrigeração constante de 8º C em geladeira comercial em quatro tempos de análise: Ovários a fresco ou sem refrigeração (GC), 12h de refrigeração (G12), 24h de refrigeração (G24) e refrigeração por 36h (G36). Realizou-se a aspiração folicular e os Complexos Cúmulus Oócitos (CCO´s) selecionados foram transferidos para placas de Petri e submetidos a maturação in vitroem estufa.  Análise histológica foi realizada para avaliar a taxa de degeneração folicular. Ao fim desse estudo, constatou-se uma diminuição de 24% na taxa de maturação dos oócitos recuperados do grupo G12 e decaimento de 67% nos oócitos dos grupos G24 e G36 e ainda diferenças morfológicas nos oócitos que podem ter atrapalhado o processo de maturação deles. A taxa de degeneração folicular foi de 51%, 15% e 10%, respectivamente. Assim sendo, infere-se que a criopreservação em geladeira (8° C) influencia negativamente na quantidade dos CCO´s rastreados, taxa de maturação citoplasmática e degeneração folicular em todos três grupos, porém com maior ênfase nos grupos refrirados por maior tempo (G24 e G36). Na etapa 2 deste trabalho teve como objetivo avaliar se a biópsia ovariana utilizando agulha tru-cut fornece material suficiente para análises de folículos pré-antrais. Para isso, foi realizado etapa in vitro com 12 ovários bovinos provenientes de abatedouro, a biópsia foi feita tangencialmente à superfície, evitando regiões de corpo lúteo ou de folículos pré-antrais, em três regiões por ovário. Os ovários foram divididos em três grupos: processamento a fresco, 12 e 24h de refrigeração. A etapa in vivo foi realizada com 5 bezerras búfalas, por meio de videocirurgia, três biópsias por ovário, um ovário por animal. As amostras in vitro e in vivo foram fixadas e processadas para análise histológica. As avaliações feitas foram de área da amostra, comprimento, qualidade do folículo, taxa de degeneração e fase da foliculogênese. Foi feita ANOVA para comparação de médias e correlação de Pearson entre o tempo de refrigeração e taxa de degeneração folicular. Em 100% das amostras em laboratório foi possível realizar as análises histológicas, fornecendo fragmentos suficiente. As biópsias feitas in vivo apresentaram área e comprimento significativamente menor (p < 0,05) se comparado a etapa anterior, com taxa de insucesso de 40%, mas ainda foi possível realizar análises de folículos pré-antrais. Nenhuma intercorrência cirúrgica foi observada no decorrer dos procedimentos nem nenhum dano pós-operatório foi identificado. Essa técnica se mostrou eficiente para os estudos histológicos pré-antrais e acesso à reserva folicular ovariana sendo promissora para obtenção de tecido ovariano para biotécnicas reprodutivas.

  • JESSICA THAYANE DA SILVA SANTOS
  • IDENTIFICAÇÃO MOLECULAR DO PIAU (ANOSTOMIDAE) CULTIVADO NO NORDESTE PARAENSE, AMAZÔNIA, E VARIABILDADE GENÉTICA DOS PLANTÉIS

  • Data: 31/08/2022
  • Mostrar Resumo
  • A família Anostomidae possui dois gêneros de importância econômica na aquicultura e pesca esportiva, o Megaleporinus e o Leporinus. Seus integrantes são conhecidos popularmente como piaus, e estão distribuídos em todas as bacias hidrográficas do Brasil. Indivíduos de espécies congêneres são muito semelhantes morfologicamente, dificultando a correta identificação, podendo mascarar a real diversidade genética desses indivíduos. Na microrregião nordeste paraense, nos últimos anos, houve um aumento no interesse pela produção desses peixes. Neste sentido, o objetivo do presente estudo foi identificar a espécie de piau que está sendo cultivada e avaliar a sua diversidade genética. Para isso, foi realizado inicialmente o mapeamento das propriedades que produzem piau. Após coleta dos indivíduos, dois marcadores mitocondriais foram utilizados, o gene Cytocromo b (Cytb), para identificação da espécie cultivada e a Região Controle (RC), para inferir os níveis de diversidade dos plantéis. Foram identificadas seis pisciculturas onde coletamos 81 amostras. Geramos um total de 107 sequencias, sendo 39 para Cytb, com sete haplótipos recuperados e 68 sequencias para RC, com 10 haplótipos recuperados. Todos os indivíduos coletados foram identificados molecularmente como Megaleporinus macrocephalus, espécie não nativa da Bacia Amazônica e foram observados baixos índices de diversidade. Com os resultados obtidos, espera-se discutir formas de manejo adequadas que considerem a diversidade genética das matrizes utilizadas nas pisciculturas da região, tendo em vista que a adaptabilidade dos organismos cultivados é influenciada pela variação genética.

  • JOSE LEOCYVAN GOMES NUNES
  • Biologia reprodutiva e Ecologia alimentar do amarelinho Baryancistrus xanthellus Rapp Py-Daniel, Zuanon & Ribeiro de Oliveira, 2011. (Siluriformes, Loricariidae) no médio Rio Xingu-Pará-Brasil. 

  • Data: 30/08/2022
  • Mostrar Resumo
  • Estudos sobre atividade reprodutiva e alimentar em peixes têm gerado subsídios para um melhor entendimento das relações entre os componentes da ictiofauna e os demais organismos da comunidade aquática. O presente estudo pretente investigar a estratégia alimentar a partir da caracterização da composição dos itens alimentares de Baryancistrus xanthellus, assim como a biologia reprodutiva dando enfoque no comportamento da população, período reprodutivo, tipo de desova, taxa de crescimento e tamanho mínimo da primeira maturação sexual. Para isso, exemplares de B. xanthellus serão amostrados na Volta Grande do Xingu, realizadas em períodos bimestrais entre julho de 2017 a junho de 2018, utilizando redes retangulares construídas com nylon multifilamentos de vários tipos de malhas (70, 80, 90, 100, 120 mm entre nós opostos) conhecida como malhadeira ou rede de espera, tarrafa ou rede de arremesso e mergulho. Ainda em campo, os espécimes serão mensurados quanto à massa corporal total (Mt/g) e comprimento total (Ct/cm). Posteriormente, os animais serão eviscerados através de uma incisão ventral a partir do orifício urogenital até a região da boca para a retirada das gônadas e estômago, preservados em Bouin e álcool 70% e encaminhados para o laboratoriO de ultraestrutura celular para análises histológicas de rotina e identificação dos item alimentares com base em chave de identificação e literatura especializada para invertebrados, para algas e para zooplâncton, além de consulta especializada, e assim poder avaliar a ecologia alimentar e reprodutiva do Baryancistrus xanthellus do médio rio Xingu.

  • GABRIEL XAVIER SERRÃO
  • Adoção de Tecnologias Digitais em Propriedades de Pecuária de Corte Bovina no Estado do Pará

  • Data: 17/08/2022
  • Mostrar Resumo
  • O setor agropecuário nacional tem vivenciado o surgimento de inovações tecnológicas digitais visando melhorar o desempenho da cadeia, atender às demandas crescentes do mercado consumidor e promover a sustentabilidade dos sistemas de produção. Considerando a importância da pecuária de corte para a economia do Estado do Pará, bem como para o Brasil, são necessários estudos visando obter um panorama do nível de digitalização da atividade no estado e fornecer subsídios para o desenvolvimento de soluções inovadoras. Objetivou-se com este estudo avaliar o emprego de tecnologias digitais e seus reflexos sobre o sistema produtivo e características socioeconômicas no contexto da terminação de bovinos de corte em diferentes propriedades do sudeste do estado do Pará. O trabalho foi dividido em três partes: problematização do processo de digitalização aplicada à terminação de bovinos de corte; artigo com os principais resultados da pesquisa; e conclusão geral. Entre janeiro e março de 2022, 24 produtores tiveram suas entrevistas validadas quanto ao uso de tecnologias e serviços digitais. Também foram levantados dados sobre o sistema de produção e o perfil dos entrevistados quanto à idade, sexo, escolaridade e residência na propriedade. As propriedades foram classificadas quanto à presença de tecnologias digitais em “Ausência Total” (N = 1), “Ausência Parcial” (N = 16) e “Potenciais Usuários” (N = 7). As relações entre essas categorias e as características foram avaliadas por meio de teste exato de Fisher a nível de significância de 5%. Houve associação significativa (P<0,001) entre as categorias de digitalização e o uso de equipamentos eletrônicos. A maioria das propriedades com ausência parcial de elementos da digitalização, 16 (66,67%), nunca empregaram eletrônicos ou o fazem raramente durante o manejo do rebanho em relação às demais (P<0,05). Não houve relação significativa (p>0,05) entre as categorias de digitalização e o uso efetivo, grau de interesse, grau de planejamento ou mesmo características do sistema produtivo e socioeconômicas. A maioria dos entrevistados afirmaram não utilizar ou utilizar de forma limitada as tecnologias (aplicativos de gestão, identificação eletrônica e drones para monitoramento, apesar de serem favoráveis a seus uso, independentemente da categoria. Entretanto, o mesmo não ocorre para a intenção de uso de serviços digitais (redes sociais, comércio de insumos e serviços digitais), rejeitadas pelos produtores. Observou-se o emprego em menor grau de dispositivos eletrônicos e a rejeição à e-commerces e serviços digitais, comportamento que pode ser explicado pelo aparente custo elevado de investimento, ausência de ambiente inovador e perfil conservador associado aos produtores brasileiros. Os produtores entrevistados compõem um grupo altamente qualificado e inserido em meio à ausência de um movimento coletivo para a inovação na região que, somado às desigualdades socioeconômicas, estabelece barreiras para o processo de digitalização dentro da porteira.


  • ANDREIA SANTANA BEZERRA DA SILVA
  • Ovinocultura de corte no brasil e na Amazônia: produção e mercado

  • Data: 01/08/2022
  • Mostrar Resumo
  • A produção ovina no Brasil tem se mostrado uma alternativa de criação para produtores de menor porte que necessita ser melhor mapeada e estudada para a identificação de pontos de crescimento potenciais. Isto contribuirá para subsidiar órgãos governamentais e agentes da cadeia na elaboração políticas públicas e projetos e intensificação das já existentes para o incremento produtivo e valorização da atividade no cenário nacional e internacional. Assim, objetivou-se com este estudo fazer uma análise da ovinocultura de corte destacando as tecnologias utilizadas nos sistemas de produção, conjuntura e aspectos mercadológicos no Brasil, bem como sua distribuição e crescimento na Amazônia Brasileira. Deste modo, em primeira instância foi realizada uma revisão sistemática da literatura fazendo uma busca por artigos indexados nas principais bases de periódicos científicos (Scopus, Web of Science, Periódicos Capes e Scielo) nos últimos cinco anos (2017-2021) realizados no Brasil. Para a análise da conjuntura e mercado de carne ovina no Brasil, bem como, para a distribuição espacial e a dinâmica de crescimento do rebanho ovino na Amazônia brasileira foram obtidos dados do Instituto Brasileiro de Geografia e Estatística e da base de dados FAOSTAT, envolvendo séries temporais no período de 1990 a 2020. Constatou-se a necessidade de estudos que apresentem tecnologias que impactem a melhoria do bem-estar animal e aquelas relativas à gestão de sistemas de produção com a raça Santa Inês. No entanto, subprodutos agroindustriais têm sido amplamente utilizados como alternativa para alimentação de ovinos Santa Inês. Observou-se que o Brasil ainda possui uma produção ovina incipiente ocupando a 23º posição dentre os países maiores produtores e teve uma oscilação no volume de importação atingindo em 2020 (3,2 mil toneladas) semelhante valor quando comparado a 1990 (3,3 mil toneladas). Os estados que demonstraram maior crescimento durante todo período estudado foram o Distrito Federal (7,88%), Mato Grosso (6,52%) e Pernambuco (6,39%). Quanto ao rebanho na Amazônia Brasileira verificou-se maior concentração no último período analisado (2020) nos estados do Pará, Mato Grosso e Maranhão com uma tendência de declínio do crescimento. Já a maior densidade do rebanho (animais por área) estava especialmente no Maranhão. Identificou-se que a maioria das tecnologias que serão aplicadas em sistemas que utilizam a raça Santa Inês está sendo estudada em estados do Nordeste. Além disso, este estudo demonstrou que a produção de carne ovina brasileira ainda é baixa, contudo, os dados históricos mostraram uma tendência de crescimento ao longo das últimas décadas. Na Amazônia brasileira os pontos potenciais de desenvolvimento identificado (microrregiões do estado do Mato Grosso, Pará, Maranhão, Tocantins e Amazonas) poderão dar suporte a um planejamento estratégico visando o fortalecimento da atividade na região. De modo geral, a pesquisa poderá subsidiar diferentes elos da cadeia produtiva, tanto os produtores, nas decisões sobre a alocação de seus meios de produção, quanto os gestores na formulação e aplicação de políticas públicas e estratégias para o desenvolvimento da ovinocultura.

  • BIANCA GOMES DA SILVEIRA
  • SUBSTITUIÇÃO DA FARINHA DE PEIXE POR FARINHA DE INSETO (Nauphoeta cinerea) EM DIETAS PARA JUVENIS DO PEIXE ORNAMENTAL AMAZÔNICO ACARÁ SEVERO (Heros severus)

  • Data: 31/05/2022
  • Mostrar Resumo
  • A farinha de peixe é a principal fonte proteica utilizada como ingrediente nas rações para a maioria das espécies na aquicultura mundial. Porém, com a finalidade de amenizar a pressão sobre os estoques pesqueiros, diversos ingredientes vêm sendo avaliados para substituir a farinha de peixe como fontes alternativas de proteína nas dietas. Nesse sentido, a farinha de inseto se destaca por apresentar perfil de aminoácidos equilibrado, além de também ser considerada boa fonte de minerais. Os insetos fazem parte da alimentação natural do acará severo (Heros severus). Dessa forma, com o presente estudo objetiva-se avaliar a substituição da farinha de peixe pela farinha de inseto (Nauphoeta cinérea) em dietas para juvenis do peixe ornamental acará-severo (Heros severus). Foram utilizados 195 juvenis de acará severo, com peso e comprimento médio inicial de 3,00 ± 0,55g e 5,00 ± 0,73cm, respectivamente. Distribuídos aleatoriamente em 15 aquários cônico cilíndrico (70L de água), na densidade de 13 peixes aquário-1. O experimento foi conduzido em delineamento inteiramente casualizado, com cinco tratamentos e quatro repetições. Os peixes foram alimentados com as dietas experimentais isoproteicas (33,92 ± 0,54% de proteína bruta) e isoenergéticas (4405,44 ± 31,78 kcal/kg de energia bruta), formuladas para apresentar níveis 0, 5, 10, 15 e 20% de farinha de inseto, referentes aos níveis de substituição de 0, 25, 50, 75 e 100% da farinha de peixe pela farinha de inseto, quatro vezes ao dia, por 60 dias. Ao longo do experimento foram coletadas amostras de fezes, para determinação da digestibilidade aparente dos nutrientes das dietas experimentais. Ao final do experimento, todos os peixes foram pesados, medidos e contados para a determinação dos parâmetros de desempenho produtivo. Em seguida, os peixes foram eutanasiados para determinação da composição corporal e o intestino foi coletado para análise de histomorfometria. Juvenis de acará severo alimentados com dietas contendo 5, 10 e 15% de farinhas de inseto apresentaram valores de ganho de peso e taxa de crescimento específico para peso estatisticamente iguais aos peixes alimentados com a dieta controle. A conversão alimentar foi melhor nos peixes que receberam dietas contendo 20% de farinhas de inseto e pior nos que receberam dietas com 10% de farinhas de inseto em substituição à farinha de peixe. Os juvenis de acará severo alimentados com dietas contendo 5% de inclusão de farinhas de inseto apresentaram valores de proteína bruta, lipídeos totais e material mineral maiores que os peixes dos demais tratamentos. Os juvenis de acará severo não apresentaram diferenças (P >0,05) nos coeficientes de digestibilidade aparente da proteína e dos lipídeos das dietas, independentemente do nível de farinha de inseto avaliado. As variáveis histomorfometricas foram melhoras nos peixes que receberam a dieta controle.

  • THAYANE SILVA MACIEL
  • Detecção de bovinos em imagens de RPA (Aeronave Remotamente Pilotada) com implementação baseada em Mask R-CNN

  • Data: 13/05/2022
  • Mostrar Resumo
  • Objetivou-se, com este estudo, realizar a detecção de bovinos de corte com base no imageamento via RPA – Aeronave Remotamente Pilotada, a partir de uma implementação baseada em Mask R-CNN.  Foram capturados vídeos de 5 a 10 minutos de um rebanho de 125 fêmeas F1 Angus-Nelore em fase final de terminação, em ambientes de pastagem e confinamento de um sistema semi-intensivo comercial em três altitudes de voo (8, 10 e 15m) do RPA. O pré-processamento dos vídeos não utilizou filtros para diminuição de ruídos e seguiu desde o particionamento em frames até a seleção de imagens aéreas digitais, que totalizaram 1.045 imagens. Foram compostos modelos com até 100 épocas e duas arquiteturas backbones do Mask R-CNN, ResNet50 e ResNet101, para cada conjunto de dados, constituídos a partir das diferentes altitudes de voos mais o database (com dados de todas as altitudes), avaliados sob as métricas LossVal_Loss e mAP. ResNet101 demonstrou melhores ajustes que ResNet50 para todos os conjuntos. Altos gaps de Loss foram encontrados para todos os conjuntos de altitudes particularizadas, assinalando overfitting. O database mostrou baixos gaps e altas precisões, com melhor desempenho para época 96 do ResNet101, com 0,2972 (Loss); 0,2422 (Val_Loss) e 93,29% (mAP). A precisão desse modelo para detecção de bovinos em confinamento (82,76%) afetou a média global. A detecção em ambientes de pastagem apresentou alta precisão (98,98%). A implementação proposta se mostrou capaz de detectar bovinos com alta precisão, especialmente em áreas de pastagens, e assinala que o imageamento pode ser realizado nas diferentes altitudes estudadas, permitindo ao gestor rural escolher a altitude de voo do RPA conforme o objetivo do monitoramento e a área a ser explorada.

  • LUCIANO DOMINGUES QUEIROZ
  • UTILIZAÇÃO DE CARBOIDRATO DIETÉTICO PELO CAMARÃO-DA-AMAZÔNIA: UMA ABORDAGEM NUTRIGENOMICA

  • Orientador : CRISTIANA RAMALHO MACIEL
  • Data: 05/05/2022
  • Mostrar Resumo
  • O objetivo do presente estudo foi de identificar e caracterizar genes relacionados a digestão de carboidratos assim como de verificar a sua expressão e o seu efeito na utilização de carboidratos de ingredientes fibrosos por juvenis de Macrobrachium amazonicum. Foi registrado no genoma funcional do hepatopâncreas do M. amazonicum duas celulases: endo-β-1,4-glucanase e endo-β-1,4-mannanase. Essas enzimas são glicosil hidrolases das famílias GH9 e GH5, respectivamente. A endo-β-1,4-glucanase apresentou toda região codificante, correspondendo a 580 aminoácidos (aa), massa molecular de 63,6 kDa e estrutura terciaria do tipo (α/α)6. A endo-β-1,4-mannanase apresentou região codificante de 372 aa, massa molecular 40,9 kDa e estrutura terciaria (α/β)8. Após a identificação e caracterização das enzimas foi realizado um ensaio de digestibilidade in vivo e um ensaio de crescimento que contribuíssem para a validação da análise genética previamente realizada. O ensaio de crescimento foi realizado em delineamento inteiramente casualizado com cinco tratamentos e três repetições. Os tratamentos foram compostos de cinco dietas purificadas isoproteicas (36,98±0,30%) e isoenergéticas (19,76±0,18 MJ/Kg), e níveis de celulose incluídos em substituição ao amido, de forma a obter dietas contendo 0,00; 8,75; 17,50; 26,25 e 35,00% de celulose. Durante 60 dias as dietas foram ofertadas ad libitum para os juvenis. Ao longo do ensaio de crescimento, foram obtidas amostras iniciais e no final do experimento, para avaliar a expressão da glucanase, com a utilização da técnica de RTPCR. Não foi identificado diferença estatística na taxa de sobrevivência, de canibalismo e na conversão alimentar entre os tratamentos. No entanto, foi observado efeito (P> 0,05) dos níveis de celulose das dietas sobre os demais parâmetros avaliados. De acordo com os valores estimados pela análise de regressão polinomial, o nível ótimo de celulose em dietas para pós-larvas de camarão-da-amazônia é 23,41%, 23,44% e 23,97%, de acordo com o peso final, ganho de peso e taxa de crescimento específico em peso, respectivamente. Enquanto que para as variáveis relacionadas ao comprimento, os valores foram estimados em 23,58% para o máximo comprimento final, 25,15% para ganho de comprimento e 29,60% para máxima taxa de crescimento especifico em comprimento. Ainda, foi observado efeito da celulose (P > 0,05) sobre a composição da proteína bruta da carcaça dos M. amazonicum. De acordo com os valores estimados pela análise de regressão polinomial, o nível ótimo de celulose em dietas para pós-larvas de M. amazonicum para melhor deposição proteica foi de 20,54% e para o menor teor de umidade foi de 23,25%. Os lipídeos totais da carcaça não apresentaram efeitos significativos. A análise da expressão genica via RT-PCR evidenciou a expressão da Endo-β-1,4-glucanase nos animais alimentados com todos os níveis de celulose dietética, tanto no início do experimento quanto no final do ensaio de alimentação validando assim nosso ensaio genético incial. O ensaio de digestibilidade in vivo foi realizado utilizando a dieta purificada do ensaio de crescimento que refletiu no melhor desempenho produtivo dos juvenis como dieta referência para avaliar a digestibilidade aparente da energia e dos nutrientes de subprodutos fibrosos regionais (coco babaçu, dendê e castanha-do-Pará). Foi também identificado e caracterizado a enzima α-amilase proveniente do hepatopâncreas de juvenis do M. amazonicum via analise in silico também com posterior validação da sua presença no genoma funcional da espécie. Com base nos resultados obtidos com o presente trabalho conclui-se que o M. amazonicum não só apresenta grande potencial em utilizar eficientemente carboidratos de origem vegetal através da identificação da expressão do gene das enzimas α-amilase, endo-β-1,4-mannanase e da endo-β-1,4-glucanase como também exige entre 23 a 29% de fibra bruta na sua dieta, que por sua vez, é utilizada como fonte energética poupadora de proteína. Conclui-se também a preferência dessa espécie em utilizar carboidratos fibrosos como fonte energética em oposição ao amido, uma vez que mesmo expressando α-amilase, foi observado melhor desempenho produtivo dos camarões alimentados com dieta contendo de 6 a 12% deste nutriente (P > 0,05).

  • ARTHUR FELIPE LIMA DOS SANTOS
  • MEDIDAS MORFOMÉTRICAS NA AVALIAÇÃO DE PESOS E RENDIMENTOS CORPORAIS DE Arapaima gigas

  • Data: 26/04/2022
  • Mostrar Resumo
  • A indústria de pescado está cada vez mais exigente, buscando peixes com tamanho, peso de abate distintos e alto rendimento dos cortes. Na piscicultura, o uso das medidas morfométricas são ferramentas para selecionar os animais a serem comercializados, contudo, somente a seleção de forma indireta não é suficiente para gerenciar as faixas de peso de abate a ser disponível no mercado. Assim, o uso de correlações lineares e parciais geram maior suporte para estimar a seleção dos animais. O pirarucu (A. gigas) devido ao sabor da carne, tem alta aceitação de mercado, contudo, é necessária uma abordagem estatística para estimar a seleção desses peixes com as exigências da indústria, sem prejudicar a economia da piscicultura. Desta forma, o objetivo do presente estudo foi avaliar a associação das medidas morfométricas e as relações diretas e indiretas sobre o peso e o rendimento do pirarucu. Para tanto, o estudo foi realizado em dois momentos, de acordo com o fornecimento deste pescado no mercado pela piscicultura Agroindústria Arima. No primeiro momento (artigo 1), utilizou-se 12 A. gigas de tamanho comercial em duas classes de peso, Classe I (6,50 a 12,99 kg) e Classe II (13,00 a 20,00 kg). E no segundo momento (artigo 2), utilizou-se 96 pirarucus (7,43±0,80 kg) com tamanho comercial. Os peixes foram beneficiados no próprio empreendimento, sendo realizado as medidas morfométricas, posteriormente, a cada etapa do beneficiamento (abate, evisceração, retirada da cabeça e corte do filé) foi mensurado o peso. Os dados foram submetidos em análises descritivas e correlações lineares e parciais. Os resultados do artigo 1, os A. gigas da classe II (13,00 a 20,00 kg) tiveram maiores valores nas medidas para peso (peso total de 15,20±2,.92 kg), comprimento (comprimento total de 1,290 ± 0,06 m) e largura (Largura do abdômen de 0,524 ± 0,04 m) em relação a classe I. Além disso, foi observado correlação positiva do peso do filé com o peso total e comprimento total dos A. gigas nas duas classes de peso, com r² acima de 0,95 e 0,75, respectivamente. Para o artigo 2, o rendimento do filé foi de 46%, com correlação linear positiva com o comprimento total (r²=0,6137) e comprimento padrão (r²=0,5821), sendo também influenciado peso da pele, peso da espinha, peso do tronco, circunferência abdominal e circunferência da cabeça, com coeficiente de determinação r² igual a 0,89. Portando, as medidas morfométricas associadas as regressões lineares e parciais pode auxiliar a seleção dos pirarucus a serem comercializados na indústria, além de estimar o maior rendimento do filé.

  • DENNER SILVA DE SOUSA
  • USO DE PROBIÓTICO NA LARVICULTURA DO PEIXE ORNAMENTAL AMAZÔNICO Nannostomus beckfordi (STEINDACHNER, 1876) DESAFIADO COM Aeromonas hydrophila

  • Data: 26/04/2022
  • Mostrar Resumo
  • O peixe ornamental amazônico Nannostomus beckfordi vem se destacando na indústria de peixes ornamentais, contudo, a larvicultura é uma fase crítica e não há informações sobre o uso de probiótico autóctone e seus efeitos benéficos a esta espécie. Logo, objetivo deste estudo foi avaliar o efeito do bioencapsulamento de naúplios de Artêmia sp. com probiótico autóctone Enterococcus faecium na modulação intestinal, crescimento e resistência à Aeromonas hydrophila das larvas de N. beckfordi. Para tanto, foi realizado o bioencapsulamento dos náuplios de artêmia com a bactéria probiótica E. faecium. O experimento foi realizado com quatro repetições e quatro tratamentos, durante 15 dias. No final foi realizado a análises da microbiota intestinal, crescimento e o desafio bacteriano com a exposição das larvas a A. hydrophila (concentração de 1.1x106 UFC.mL-1). Houve aumento das bactérias ácido láticas com redução das bactérias heterotróficas totais para as larvas que foram alimentadas com Artêmia sp. bioencapsulada com E. faecium. Observou-se também, o aumento no comprimento total (1,24±0,02 mm) e peso final (12,17±0,13 mg), assim como a resistência a A. hydrophila das larvas de N. beckfordi alimentadas com Artêmia sp. bioencapsulada com E. faecium na concentração de 1,4x108 UFC.mL-1. Portando, o bioencapsulamento de Artêmia sp. com E. faecium proporciona efeitos benéficos na modulação da microbiota intestinal, crescimento, sobrevivência e resistência a A. hydrophila das larvas de N. beckfordi.

  • BRENDA MARIA PEREIRA ALHO DA COSTA
  • ANESTESIA E QUIMIOPROTEÇÃO EM JUVENIS DE TAMBAQUI Colossoma macropomum EXPOSTOS AO MENTOL: ATIVIDADE NEURONAL, MUSCULAR, CARDIORRESPIRATÓRIA E STATUS OXIDATIVO


  • Data: 20/04/2022
  • Mostrar Resumo
  • O presente trabalho objetivou avaliar o comportamento, a neurodepressão, o miorrelaxamento, a atividade cardiorrespiratória e o status oxidativo em juvenis de tambaqui, Colossoma macropomum, expostos à duas concentrações de mentol utilizando marcadores eletrofisiológicos e de estresse oxidativo (EOx). Inicialmente, foram registradas as latências para a anestesia e a recuperação, e avaliados a eletroencefalografia (EEG), a eletromiografia (EMG), a eletrocardiografia (ECG) e o batimento opercular (OBR) utilizando-se banhos de mentol a 100 mg/L. Nestes ensaios, os peixes foram divididos em três grupos para todas as caracterizações: (a) controle; (b) etanol (controle veículo); e (c) mentol a 100 mg/L. Foram utilizados nove animais por grupo para cada marcador, sendo cada peixe considerado uma réplica (n = 9) e utilizado apenas uma vez. Na avaliação comportamental os tempos de indução e recuperação anestésica observados foram abaixo de três e cinco minutos respectivamente, dentro dos limites máximos de tempo recomendados para peixes expostos à anestesia em banhos. No EEG, observou-se que o mentol induziu a diminuição da potência média na atividade cerebral, deprimindo de forma reversível o SNC, com retomada da atividade ao longo da recuperação, sem sinais de padrões convulsivos ou quaisquer outras alterações observáveis. O EMG mostrou um tônus muscular esquelético diminuído, sem excitabilidade ou presença de espasmos. O ECG mostrou uma frequência cardíaca reduzida, característica de anestesia, sem alterações importantes na duração do complexo QRS durante a indução ou recuperação. Para todos os registros o ritmo sinusal foi mantido, sendo que o mentol não levou ao prolongamento demasiado do intervalo QT, e o intervalo RR refletiu um efeito anestésico reversível. O OBR demonstrou a manutenção da frequência ventilatória durante a indução e a recuperação, o que indica um risco reduzido de hipóxia severa. Nos ensaios de EOx foram utilizadas duas doses de mentol, uma de anestesia rápida (100 mg/L) e outra de sedação (20 mg/L), em dois períodos, durante a indução e após 30 minutos de recuperação, utilizando-se os marcadores GST, ACAP e TBARS em fígado, cérebro, brânquia e músculo. Os animais foram divididos em seis tratamentos (n = 8). No geral, a ACAP não apresentou diferenças nos tratamentos quando comparados ao controle no fígado e no cérebro, mas apresentou no músculo e nas brânquias, onde observou-se no músculo uma diminuição da ACAP no tratamento de maior tempo de exposição. Nas brânquias o comportamento foi semelhante, a ACAP diminuiu nos dois tratamentos de exposição ao mentol, porém em ambos os casos a ACAP reestabeleceu os valores comparados ao controle após 30 minutos de recuperação. A atividade de GST aumentou no fígado e na brânquia, indicando efeito de uma resposta antioxidante. A LPO não aumentou em nenhum tratamento durante a exposição ou recuperação em todos os tecidos, entretanto, houve diminuição na LPO no fígado na concentração de 100 mg/L. Diante dos resultados, verificou-se que o mentol mostrou-se um anestésico eficaz e com boa margem de segurança para juvenis de tambaqui, não causando alterações deletérias nos padrões dos traçados eletrofisiológicos e mantendo um ritmo cardiorrespiratório seguro. Demonstrou também um potencial de ativação do sistema antioxidante e de proteção contra danos lipídicos provenientes das EROs, sendo uma boa alternativa de quimioproteção para os tecidos.

  • SHERYLE SANTOS HAMID
  • Pecuária bovina no estado do Pará: dinâmica espaço temporal do rebanho e mudanças na eficiência da produção

  • Data: 17/03/2022
  • Mostrar Resumo
  • Em 2020, o rebanho bovino paraense foi estimado em 22,3 milhões de cabeças, terceiro maior do país, e enquanto a área com pastagem ocupou 21,5 milhões de hectares no estado, sendo a maior do país. Essas estimativas são resultados da crescente valorização da atividade no Pará, onde os sistemas de produção passam por profundas transformações em função de fatores tecnológicos, ambientais e econômicos. A dissertação foi composta por dois capítulos, elaborados a partir de dados oficiais. No primeiro capítulo foi analisada a dinâmica do rebanho bovino a partir de dois indicadores, a densidade bovina (cab./km²) e a taxa geométrica de crescimento (% ao ano), no período de 2000 a 2020, em recorte municipal, utilizando um método de econometria espacial denominado Análise Exploratória de Dados Espaciais (AEDE). Os resultados obtidos indicaram, ao mesmo tempo, o gradativo aumento da densidade bovina nos municípios localizados no sudeste do estado e proximidades, bem como o efeito de transbordamento nesta região, onde os clusters de crescimento localizaram-se, principalmente, nos limites entre o sudeste e sudoeste do estado, revelando a orientação do crescimento em direção ao sudoeste e o declínio, principalmente, nos municípios localizados ao norte do estado. No segundo capítulo, foi calculada a eficiência da pecuária bovina considerando o recorte microrregional em dois períodos, os anos de 2006 e 2017, com o uso do método de programação linear denominado Análise Envoltória de Dados (DEA) e, conjuntamente com Índice de Malmquist, foi possível calcular as mudanças da produtividade, da fronteira tecnológica e da eficiência. Foi utilizada a Regressão Tobit para avaliar os efeitos de variáveis contextuais sobre o escore de eficiência em 2017. A eficiência média foi de 0,75 e 0,76 em 2006 e 2017, respectivamente, indicando que a receita bovina no estado poderia aumentar em 25 e 24% em cada ano, mantendo os mesmos níveis de inputs no estado. Em cerca de 94,1% das microrregiões houve progresso tecnológico, em 52,9% ocorreu o aumento da eficiência, resultando no aumento da produtividade em 88,2% das microrregiões. O preço da terra e o crédito rural apresentaram efeitos positivos sobre a eficiência, enquanto o percentual de produtores familiares, a especialização da lavoura de soja e desmatamento apresentaram relação negativa com a eficiência. Tais resultados colaboram na orientação do desenvolvimento sustentável da atividade no estado e apontam fatos portadores de futuro que poderão ser estudados posteriormente.

  • MARCELA PIMENTEL DE ANDRADE
  • VARIABILIDADE ESPAÇO-TEMPORAL DA ESTRUTURA E DINÂMICA DO MESOZOOPLÂNCTON EM UM ESTUÁRIO TROPICAL DO LITORAL AMAZÔNICO (CAETÉ, PARÁ, BRASIL)


  • Data: 17/03/2022
  • Mostrar Resumo
  • No presente estudo, analisamos a estrutura e composição das assembleias mesozooplanctônicas e suas variações espaço-temporais com base em diferentes estatísticas uni-multivariadas. As coletas foram realizadas durante marés de quadratura e sizígia, em três setores fixos localizados ao longo do estuário do Caeté, município de Bragança/Pará (estuário superior-S1, médio-S2 e inferior-S3), utilizando para tais redes cônicas de plâncton com aberturas de malha de 200 μm. As amostragens de plâncton e águaocorreram em outubro, dezembro de 2013 e setembro 2014 (estação seca) e em junho de 2013, abril, junho de 2014 e março de 2015 (estação chuvosa). As amostras foram coletadas durante as marés de enchente e vazante, em intervalos regulares de 3 horas ao longo de um período de 24 horas, totalizando 189 amostras. O estuário do Caeté é caracterizado como um ambiente altamente variável química e fisicamente, que é afetado pelos altos níveis de precipitação, descarga de água doce e pelo ciclo das marés. A salinidade foi a principal variável responsável pela manutenção do padrão espacial no estuário estudado. As assembleias do zooplâncton exibiram variabilidade espacial e temporal em resposta às condições ambientais e hidrológicas dinâmicas que variam de acordo com a posição dentro do gradiente estuarino. Este grupo de organismos foi distribuído ao longo do gradiente de salinidade de acordo com as tolerâncias fisiológicas específicas de cada táxon. As assembleias do zooplâncton são ainda reguladas pelo tempo de residência na água, com maior abundância e produção geralmente associadas a tempos de residência mais longos e taxas mais baixas de transporte advectivo. Os resultados também ressaltam a alta diversidade do zooplâncton em estuários dominados por manguezais, com 25 espécies identificadas, representadas principalmente pelo grupo Copepoda. A ocorrência do evento de seca em junho de 2013 foi marcada pela baixa pluviosidade e consequentemente pelo menor fluxo dos rios, aumento da salinidade e maiores concentrações de

    nitrato (NO-3), nitrogênio inorgânico dissolvido (NID), ortofosfato (PO34-) e silicato dissolvido (SiD), que foram responsáveis pela alta biomassa fitoplanctônica (clorofila-a) registrada neste período. Essas condições permitiram o aumento substancial na densidade populacional de copépodos, particularmente em direção ao estuário a jusante, que foi dominado por espécies estuarinas e costeiras, como Pseudodiaptomus richardi (895 ± 1.878 ind.m-3p<0,05), Oithona hebes (74 ± 667 ind.m-3), Acartia lilljeborgii (1.045 ± 1.675 ind.m-3p<0,05), Acartia tonsa (926 ± 1.165 ind.m-3) e Paracalanus quasimodo (349 ± 614 ind.m-3), que apresentou densidades maiores em jun/2013 do que as obtidas no período normal de precipitação (jun/2014). Além disto, observamos que a biomassa mensal dos copépodos e a produtividade em um estuário dominado pelo ecossistema de manguezal tropical podem ser relativamente altas em comparação com outras águas lagunares, estuarinas e neríticas do mundo. A alta produtividade dos Pseudodiaptomus no estuário do Caeté pode ser atribuída às altas temperaturas durante todo o ano, salinidade moderada, elevada biomassa fitoplanctônica, a água sendo rica em matéria orgânica particulada que se origina da serapilheira de bosques de mangue, capacidade de consumir células de um amplo espectro dimensional, e maiores taxas de produção de ovos, como observado para P. richardi (com picos de até 938,7 ± 1.681,2 mg C m-3 d-1p<0.0001). De forma geral, pode-se concluir que a salinidade influenciou de forma significativa a estrutura da comunidade do mesozooplâncton, tanto em termos de densidade como de produtividade. Os baixos valores observados para os índices ecológicos ocorreram possivelmente em virtude da redução do aporte de água marinha no Caeté, sendo este ocasionado pelo aumento da precipitação e descarga fluvial na região. A alternância espaço-temporal entre as principais espécies estudadas, determinada por suas tolerâncias inter- e intraespecíficas às variações de salinidade, demonstraram a ocorrência de um processo de sucessão envolvendo estas espécies durante o período de estudo. Não obstante, fatores como a predação e a competição podem estar atuando neste processo, muito embora, até o presente momento, não seja possível dimensionar a real importância desses fatores na estruturação das comunidades planctônicas do Estuário do Caeté.

     

  • AMANDA MENDONÇA DE OLIVEIRA
  • Distribuição espacial e fontes de crescimento da pecuária leiteira no estado do Pará

  • Data: 16/03/2022
  • Mostrar Resumo
  • A pecuária leiteira no estado do Pará encontra-se em expansão, com amplo potencial produtivo e grande importância no desenvolvimento econômico e social, sendo fonte de abastecimento de produtos lácteos no mercado interno, o que gera empregos e renda para a população. A atividade é marcada pela heterogeneidade entre os produtores, decorrente da maioria da produção leiteira ocorrer em pequenas propriedades, com rebanho de dupla aptidão, adoção de baixo nível tecnológico, falta de assistência técnica, entre outros entraves que afetam diretamente a cadeia produtiva e o desempenho do rebanho leiteiro. Logo, objetivou-se com o estudo realizar um levantamento da conjuntura da produção de leite no Brasil e estado do Pará, e especificamente a nível estadual: identificar a distribuição espacial e nível de especialização a partir dos dados do Censo Agropecuário (2006 e 2017); analisar as fontes de crescimento da bovinocultura leiteira por microrregiões, no período de 1990 a 2020, com base na pesquisa da pecuária municipal (IBGE). Para avaliar o nível de concentração espacial, foram determinados o Quociente Locacional e o Índice de Gini. A avaliação das fontes de crescimento utilizou-se do método Shif-share, com função de identificar e decompor os componentes de crescimento da atividade. Os resultados evidenciaram que o Brasil ocupa a terceira posição no ranking de maiores produtores mundiais de lácteos, produzindo 36,5 bilhões de litros, mas com produtividade animal abaixo da média global. No estado do Pará, a produção atingiu 600 milhões de litros de leite, produtividade de 734 litros/vaca em 2020. O índice de concentração exibiu incremento de 88%, saltando do valor de 0,25 para 0,47 em 2017, demonstrando maior centralização da atividade leiteira. Quanto a especialização na produção de leite, no ano inicial do estudo havia nove microrregiões especializadas, entretanto, no ano final apenas seis se enquadram nesta classificação, sendo Parauapebas, Marabá, Tucuruí, Redenção, São Félix do Xingu e Altamira, destaca-se o Sudeste Paraense como principal polo leiteiro do estado, que engloba municípios de tradição na pecuária leiteira, como Água Azul do Norte, maior produtor estadual de leite desde o ano de 2012. O efetivo crescimento da produção de leite referente aos anos de 1990 a 2020, retratou aumento da produção estadual de 3,23% ao ano, com maior contribuição nesse crescimento dos ganhos de produtividade do rebanho, do que em relação ao feito expansão do rebanho, no entanto dez microrregiões apresentaram taxa média anual negativa de crescimento, estando localizadas no Nordeste Paraense, Marajó e Região Metropolitana de Belém, resultado proveniente da redução do efeito expansão do rebanho, pois o efeito produtividade todas as microrregiões exibiram taxas positivas, com exceção de Cametá e Arari. A retração mais acentuada ocorreu em Arari, com queda brusca na produção de leite, quantitativo de animais ordenhados e rendimento das vacas. As doze microrregiões com taxas anuais positivas estão situadas nas mesorregiões do Sudeste Paraense, Sudoeste Paraense e Baixo Amazonas, nove associadas ao crescimento intensivo e três mais ligadas ao crescimento extensivo. De modo geral, os resultados evidenciam que as regiões especializadas na atividade são mais articuladas apresentando os percentuais mais altos quanto ao quantitativo produzido, plantel ordenhado e movimentação financeira, em comparação com as localidades não especializadas. Por meio das análises, é possível obter melhor entendimento do processo de crescimento regional, com foco na atividade leiteira, pois as informações e particularidades das propriedades são fundamentais para nortear as instituições públicas e privadas da realidade e os problemas existentes, possibilitando a readequação e novas formulações de políticas com intuito de amenizar as limitações dos produtores, assim como, potencializar o crescimento e diminuir desequilíbrio intra e inter-regional. 

  • ANELISE DE SARGES RAMOS
  • Produção in vitro de Embriões bubalinos na Ilha do Marajó 

  • Data: 24/02/2022
  • Mostrar Resumo
  • Os métodos de biotécnicas reprodutivas são quase todos aplicados na espécie bubalina, embora à maioria não seja tão eficiente como em bovinos, apresentando um rendimento relativamente baixo na aspiração folicular – Ovum pick-up (OPU) e na produção in vitro de embriões (PIVE) e com pouca aplicação comercial quando comparado a outras espécies animais. Tais fatos podem ser explicado devido as características particulares da espécie, como sazonalidade reprodutiva (períodos reprodutivos favorável e desfavorável), dificuldade de identificação do estro e dificuldade na seleção de touros para a coleta de sêmen a ser utilizado na fertilização in vitro para melhorar as taxas de fertilidade. Assim, surge à necessidade em se estudar os fatores necessários para melhorar a taxa de sucesso da aplicação dessas biotecnologias nesta espécie. Objetivou-se analisar a sazonalidade reprodutiva em búfalas no Marajó, durante o período reprodutivo favorável e desfavorável, seus efeitos na produção in vitro de embriões (PIVE) a partir de Ovum Pick-up (OPU) e na taxa de embriões produzidos utilizando sêmen criopreservados de diferentes touros. O experimento foi conduzido no Laboratório de Produção in vitro de Embriões, instalado na Escola de Ensino Técnico do Estado do Pará (EETEPA), no Município de Salvaterra e as coletas foram realizadas em uma fazenda no Município de Cachoeira do Arari, ambos localizados na Ilha do Marajó, no período compreendido de janeiro de 2021 a janeiro de 2022. Foram selecionadas 40 fêmeas para as sessões de OPU e três touros para a coleta seminal, da espécie bubalina, raça Murah, em idade reprodutiva, com disponibilidade de pastagens, água, mineralização e suplementação. Os machos foram utilizados para congelação seminal onde testou-se dois diluidores um comercial (BotuBov®) e outro não comercial (Tes-Tris), a fim de se utilizar o de melhor resultado na PIVE. As fêmeas passaram por sessões de OPU’s e o material genético feminino coletado seguiu para o processo de PIVE (maturação, fertilização e cultivo in vitro) e ao final de seis dia foram avaliadas as taxas de embriões produzidas. Foram congeladas 300 palhetas de sêmen de cada touro e após as análises físico-químicas do sêmen pós- criopreservação, foi observado diferença significativa (p<0,05) para a motilidade progressiva dos diluidores BotuBov® (70,70%±10,90%) e Tes-Tris (60,42%±6,00%), sendo o diluidor comercial utilizado na PIVE por apresentar o melhor resultado. As variáveis consideradas e analisadas, após cincos sessões de OPUs, foram:  influência da estação reprodutiva favorável (chuvoso) e desfavorável (seco), no período chuvoso observou-se que as médias de número de folículos aspirados (11,75±5,23), de folículos por animal (11,23±1,39), de CCOs rastreados (105±61,65) e de CCOs rastreados por animal (5,96±1,56) não diferiram estatisticamente (p>0,05) das respectivas médias também analisadas e comparadas, as quais foram:12,47±4,86, 11,74±1,04, 118,5±12,02 e 7,27±0,83, no período seco; influência da presença do corpo lúteo e de folículos dominantes em relação a quantidade de folículos aspirados, número de CCOs aspirados, número de CCOs para FIV e número de CCOs viáveis, não apresentaram diferença estatística entre as variáveis analisadas (p>0,05); influência do escore de condição corporal (ECC), a partir da divisão em 02 grupos (G1 e G2): o G1 (ECC ≤ 3) e G2 (ECC > 3) e após análise estatística os grupos não apresentaram diferença estatística (p>0,05) entre nenhuma das variáveis comparadas (quantidade de folículos aspirados, número de CCOs aspirados, número de CCOs para FIV e número de CCOs viáveis); influência do efeito da estação reprodutiva favorável ou desfavorável nas taxas de embriões, no chuvoso (25,25%±0,64%) e no seco (19,37%±14,06%), porém não houve diferença estatística (p>0,05) entre os parâmetros analisados e para a influência da taxa de embriões do sêmen de três diferentes touros, também não foram encontradas diferença estatística (p>0,05), touro 1 com 59,33%±22,27%; touro 2 com 38,29%±20,35% e touro 3 com 54,17%±31,55% de taxa de embriões para cada touro.Os resultados apresentados podem ser considerados satisfatórios, permitindo concluir que a sazonalidade de fêmeas bubalinas não sofreu interferência nas variáveis reprodutivas das OPU/PIVE e que o sêmen criopreservado de diferentes touros não influenciou na taxa de embriões. Sendo possível prever maiores e melhores resultados com a continuidade no uso da biotécnicas reprodutivas aplicadas aos bubalinos nos próximos anos na região do Marajó.

  • JORGE CARDOSO DE AZEVEDO
  • Perspectiva sustentável para a exploração da agropecuária no arco do desmatamento da Amazônia: mudanças no uso da terra e os estoques de C e N no solo

  • Data: 22/02/2022
  • Mostrar Resumo
  • O Brasil destaca-se globalmente por ser um dos maiores emissores de dióxido de carbono (CO2) do mundo, associado muitas vezes a mudanças no uso da terra e ao desmatamento principalmente do bioma amazônico. Devido ao aumento no preço das terras agrícolas nas demais regiões do país, nas últimas décadas a maior parte do avanço da fronteira agrícola tem ocorrido em direção a região Norte do Brasil (bioma Amazônico). Essa região de fronteira da Amazônia Legal é caracterizada por áreas suprimidas e conhecida como arco do desmatamento da Amazônia. Nessa região as sucessões típicas do uso da terra, como o uso de pastagens e agricultura podem afetar a dinâmica do carbono e nitrogênio no solo. Diante disso, a capacidade de absorção de C dos solos pode ser aumentada através da adoção de melhores práticas de manejado nos diferentes sistemas agropecuários. Assim consequentemente teríamos um aumento da concentração de C orgânico, melhorias nas propriedades químicas, físicas, biológicas e ecológicas do solo. Portanto, esse trabalho foi dividido em dois capítulos, em que o primeiro é uma revisão para avaliar como as diferentes práticas de uso e manejo da terra (agricultura, pecuária e floresta), afetam os estoques de C do solo na região Amazônica. O segundo possui o objetivo de determinar o efeito na mudança do uso da terra sobre os estoques de C (ECO) e N (ENO) orgânico em solos de áreas de pastagens nominais, agricultura e floresta tropical primária perturbada, no arco do desmatamento da Amazônia. Amostras foram tomadas para avaliar a textura, densidade, concentração de carbono orgânico e nitrogênio do solo. Além disso, foi avaliado estoques de C e N em 30 e 100 cm de profundidade, e abundância de 13C isotópico. Todos os sistemas apresentaram uma textura de solo semelhante para o conteúdo de argila 293,8; 286,7; 240,0 g kg-1. O sistema agrícola apresentou uma maior densidade que os demais apenas nas camadas superficiais (0-30 cm). A concentração de C e N na agricultura foi a menor que nos demais uso da terra. Os sistemas de pasto e floresta não diferiram entre si em relação aos SOC e ENO, mas foram maiores do que a área de agricultura, independente da profundidade. A conversão da floresta em sistemas agrícola causa perdas de C e N. Sistemas de pastagem mantem o C e N armazenado no solo, sendo que parte do C3 oriundo da floresta é substituído pelo C4 em até 100 cm de profundidade do solo. 

  • BRUNO JOSE CORECHA FERNANDES EIRAS
  • Moina sp. como alternativa de alimento vivo para a larvicultura dos peixes ornamentais amazônicos acará bandeira (Pterophyllum scalare – Schultze, 1823) e acará severo (Heros severus – Heckel, 1840)

  • Data: 08/02/2022
  • Mostrar Resumo
  • O acará bandeira (Pterophyllum scalare) e acará severo (Heros severus) são espécies de ciclídeos endêmicos da bacia do rio Amazonas. Ambas as espécies possuem importância no mercado ornamental, em virtude da beleza exuberante e rusticidade que são característica importantes para criação em cativeiro. Um dos gargalos na piscicultura destas espécies é a larvicultura, esta fase de cultivo de peixes é considerada um dos pontos críticos na criação, devido a maior fragilidade e vulnerabilidade dos animais. Para o sucesso da produção de pós-larvas, a nutrição é um dos pontos fundamentais e os alimentos vivos correspondem a principal fonte alimentar. Os cladóceros são utilizados como alimento vivo pelo bom valor nutricional, boa aceitabilidade e facilidade de cultivo. Os organismos do gênero Moina destacam-se entre os cladóceros utilizados como alimento vivo pelo seu reduzido tamanho e proporção de proteína bruta. Neste contexto, o objetivo do presente estudo foi avaliar a influência da substituição de náuplios de Artemia sp. por Moina sp., a taxa e frequência alimentar ideal para fornecimento de Moina sp. e a transição alimentar de Moina sp. para dieta inerte sobre o desempenho produtivo, histomorfometria intestinal, custo do alimento vivo e da mão de obra durante a larvicultura do acará bandeira e acará severo. Para tal, foram organizados três artigos. O primeiro artigo, representado pelo capítulo 2, compõe dois experimentos de substituição de náuplios de Artemia sp. por Moina sp. durante a larvicultura do acará bandeira e acará severo. O segundo artigo, representado pelo capítulo 3, compõe dois experimentos para determinar a taxa e frequência alimentar ideal para fornecimento de Moina sp. durante a larvicultura do acará bandeira e acará severo. O terceiro artigo, representado pelo capítulo 4 compõe dois experimentos para verificar o melhor tempo de transição alimentar entre a Moina sp. e a dieta inerte durante a larvicultura do acará bandeira e acará severo. De acordo com os resultados obtidos nos experimentos realizados, concluiu-se que a substituição mínima de náuplios de Artemia sp. para Moina sp. para promover melhores resultados de desempenho produtivo durante a larvicultura do acará bandeira e acará severo foi de 75% de náuplios de Artemia sp. e 25% de Moina sp. Embora a histomorfometria intestinal de pós-larvas de acará bandeira não foi afetado pela proporção de alimento vivo ofertado, as pós-larvas de acará severo apresentaram menores alturas e área das vilosidades intestinais quando alimentados com 100% de Moina sp. Para ambas as espécies, o custo do alimento vivo foi diretamente proporcional à inclusão de náuplios de Artemia sp. na alimentação, sendo maior nos animais alimentados com 100% de náuplios de Artemia sp. As pós-larvas de acará bandeira e acará severo que consumiram 400 Moina sp. pós-larva-1 dia-1 obtiveram os melhores resultados da maioria das variáveis de desempenhos produtivos. Muito embora, as pós-larvas de acará bandeira que consumiram 300 e 400 Moina sp. pós-larva-1 dia-1 obtiveram maiores valores de altura e área das vilosidades intestinais. A frequência alimentar não afetou o desempenho produtivo e a histomorfometria intestinal de ambas as espécies. O custo da Moina sp. foi proporcional ao aumento da taxa alimentar, sendo maior em ambas as espécies alimentadas com 400 Moina sp. pós-larva-1 dia-1. Já o custo da mão de obra foi maior nos animais alimentados quatro vezes ao dia. Desta forma, recomenda-se que as pós-larvas de acará bandeira e acará severo sejam alimentadas a 400 Moina sp. pós-larva-1 dia-1, dividido em duas vezes ao dia. Para ambas as espécies, a transição alimentar ideal de Moina sp. para dieta inerte que proporcionou os melhores resultados de desempenho produtivo ocorreu no décimo quinto dia de experimento, muito embora o custo da alimentação foi proporcional ao tempo de alimentação com Moina sp., sendo maior nas pós-larvas que consumiram Moina sp. durante 20 dias. Desta forma, recomenda-se que a transição alimentar seja realizada no décimo quinto dia de cultivo.

  • CAIO SANTOS SILVA
  • CARACTERIZAÇÃO DE POLIMORFISMOS NOS GENES LEPTINA, SCD E MELATONINA EM BÚFALAS (Bubalus bubalis) NA AMAZÔNIA

     
  • Data: 20/01/2022
  • Mostrar Resumo
  • No Brasil, a criação de búfalos vem se desenvolvendo em larga escala, com crescimento anual de 4,3%. O Brasil possui 1.3 milhões de animais e a região norte concentra 64,1% desse efetivo, a região nordeste 9,7%, a sudeste 11,5%, a sul 9,0% e o centro oeste 5,8%, sendo o estado do Pará o principal criador com 38,6% dos búfalos do Brasil, seguido do Amapá com 18,1%. O objetivo deste trabalho foi avaliar geneticamente as populações de búfalas por meio da reação em cadeia da polimerase (PCR) e das técnicas de polimorfismo no comprimento do fragmento de restrição (RFLP) nos genes da leptina e estearoil-CoA dessaturase (SCD) e polimorfismo de conformação de fita simples (SSCP) para o gene da melatonina, e associar os genótipos à produção de leite. Foram avaliadas 69 amostras de Bubalus bubalis - 38 da raça Murrah, 18 mediterrâneo e 13 mestiças da raça Murrah com Mediterrâneo. As frequências de alélicas e genotípicas, a heterozigosidade observada e esperada, os coeficientes de endogamia (FIS), as probabilidades de equilíbrio de Hardy-Weinberg, a estatística F para diferenciação populacional e o índice de Shannon foram calculados usando os programas GENEPOP e GenALEx. As associações dos diferentes genótipos com o papel na produção de leite foram testadas por Análise de Variância (ANOVA) e teste t. Nós relatamos a contribuição alélica dos genes da leptina e do SCD para a variabilidade genética em rebanhos bubalinos na região amazônica brasileira. O alelo A foi o mais representativo para todos os genes da em todos os grupos raciais. Nenhum efeito significativo entre os genótipos e a produção de leite foi encontrado no presente estudo, mas há um indicativo de que o genótipo AA no gene da leptina afeta a produção de leite na raça Murrah.

2021
Descrição
  • AGATHA GUELRETH FARIAS DE SOUZA
  • Avaliação de diferentes corretivos na formação de pastagem

  • Data: 21/12/2021
  • Mostrar Resumo
  • Objetivou-se avaliar o efeito de diferentes corretivos do solo na formação de pastagem e produção de forragem do capim Brachiaria brizantha cv. Xaraés. O delineamento experimental foi em blocos casualizados, no esquema fatorial 3x4. Foram testadas três tratamentos relacionados a correção do solo: controle (sem correção +NPK), calcário +NPK, cal virgem +NPK, em combinação com quatro tempos de incubações dos corretivos no solo: 14, 28, 56 e 84 dias antes do plantio, totalizando 60 unidades experimentais. Foram feitas três análises químicas do solo, para caracterização, no momento do plantio e fim do ciclo. Foi avaliado a morfogênese e estrutura, produção e composição química da cv. Xaraés. No plantio, o pH (H2O) foi 6,8 no calcário e 8,2 na cal. Ca, Mg, MO e V% foram maiores na cal, o P do calcário foi menor que da cal. No fim do ciclo, o pH do calcário foi de 6,6 e cal de 7,6. Houve interação para Ca, Mg, K, P, MO e V%. Os corretivos foram efetivos em reduzir o Al+3. A duração de vida da folha, taxa de senescência foliar e tamanho final de folha, tiveram efeito do tempo de incubação. A produção total de MS por vaso foi maior com a aplicação do calcário e o comprimento de raiz maior na cal. Devido ao maior poder de reação a recomendação de uso da cal virgem deve ser melhor estudada visando evitar problemas associados à um pH alcalino.

  • DEBORA DA VERA CRUZ ALMEIDA
  • Casuística de Xenarthras atendidos no Hospital Veterinário da Universidade Federal do Pará (janeiro de 2013 a agosto de 2020): Medicina aplicada a fauna Amazônica Oriental.

  • Data: 17/12/2021
  • Mostrar Resumo
  • Profissionais veterinários especialistas em animais das ordens Cingulata e Pilosa apresentam dificuldade para o atendimento médico assertivo, devido ao baixo número de publicações sobre relatos bem sucedidos nestas espécies. Desse modo, objetivou-se realizar um estudo casuístico de Xenarthras atendidos no Hospital Veterinário da UFPA, e relatar os principais casos clínicos e/ou cirúrgicos considerados inéditos ou que tiveram boa resolução. Os dados foram obtidos a partir dos prontuários dos pacientes atendidos no Setor de Animais Silvestres do Hospital Veterinário (SAS-HV) da Universidade Federal do Pará (UFPA), localizada no município de Castanhal, estado do Pará. Foi admitido um total de 92 animais (66 Bradypus variegatus, 10 Choloepus didactyla, 15 Tamandua tetradactyla e um Dasypus novemcinctus). As principais circunstâncias que levaram ao atendimento foram animais para triagem (42%, n=39); filhotes vulneráveis (9%, n=8); atropelados por veículo (8%, n=7); alterações respiratórias (7%, n=6); queda de árvore (5%, n=5); choque elétrico (5%, n=5); agressão por cão (4%, n=4) e agressão por humano (4%, n=4). Quanto à destinação dos animais, a soltura foi representativa para a maioria das espécies. Foram descritos dois casos clínico-cirúrgicos envolvendo uma espécie de C. didactyla e uma T. tetradactyla, vítimas de trauma elétrico. O tratamento dos pacientes envolveu ações integradas de cuidado ao paciente, incluindo pronto atendimento, estabilização, procedimento cirúrgico e cuidados hospitalares. Para o tratamento da C didactyla, as cirurgias de amputações foram um dos pontos relevantes para garantir a sobrevida do animal. O tratamento para T. tetradactyla foi baseado na cirurgia de desbridamento das lesões e na cicatrização por segunda intenção. O estudo casuístico foi de grande importância para o levantamento epidemiológico dos animais atendidos no Hospital veterinário, bem como para a descrição de protocolos para o tratamento de duas espécies de Xenarthra vítimas de trauma elétrico.

  • JUDISON RENAN GEMAQUE
  • Avaliação da Técnica e Estudo Anátomo-Radiográfico do Úmero e Tibiotarso de Accipitriformes

  • Data: 10/12/2021
  • Mostrar Resumo
  • Background: The radiological evaluation is still an undeniably efficient and fast diagnostic imaging method. Obtaining radiographic references such as the Ordem das Aves in this work is relevant for Veterinary Medicine, as it may in the future help in the clinic and surgery of similar specimens, with a shortage of studies that include more families of Brazilian avifauna, which may be under conservation measures or endangered. The objective of this work is to correlate the size of birds with their cortical and medullary thickness areas of the humerus and tibiotarsus and to evaluate the technical dose used for the measurements of the bones in an assertive way.

     Materials, Methods and Results: 19 birds of the Order accipitriformes were used in the study, being part of the specimens from the frozen anatomical collection of the Federal University of Pará (UFPA) and others from the Mangal das Garças Ecological Park. The studies were carried out at UFPA and at the Federal Rural University of Amazônia (UFRA). The animals were radiographed in a single exposure to detect the humerus in a mediolateral view and in the craniocaudal view of the tibiotarsus. The dosing techniques of six canine specimens were randomly obtained for a comparative study of that used in birds for reference purposes and evaluation of significant differences between studies of radiographic techniques.

     Discussion: It was found that the specimens Heterospizias meridionalis and Geranoaetus albicaudatus are radiographically larger in their measurements of their cortical and medullary areas than the other specimens of the Order. The species Rupornis magnirostris was the most demanded bird in the study. Regarding the measurements of the humerus and tibiotarsus, they were the same on both sides. The medullary longitudinal areas of the right humerus (AMLUD), transverse right humerus (AMTUD) and transverse right tibiotarsus (AMTTD) showed the highest correlations with each other. This correlation is relevant because, based on information like this, it is possible to establish the issue of implant placement, scar, types of materials, even the type of surgical technique to be used in each case [3]. As a rule, the longer the bone, the larger its cortical and medullary zones, which was confirmed in the research results. The present study suggests that, in the order of accipitriforms, there is a strong and positive correlation according to [15], as 85.72% of the results remained in the reference range of 0.70 to 0.89. The study also confirms that birds have unique anatomical characteristics due to their ability to fly and their appendages have a larger medullary channel than other species, with a thinner cortex, making them subject to fractures [7]. The t test of the two species showed that there was no significant difference between the doses for kV, mAs and T. Significance range (p < 0.05). Where I depend on the acquisition of diagnostic images, radiographic technical factors directly influence the quality of the exam. It is also verified that in the experiments carried out with the canine species, authors such as [2, 4, 16] mention only the dose limits or only the brand of equipment, not detailing the dosage techniques used in the various experiments carried out. . with the species. Data notation and calculation are relevant for evaluating dosing techniques along with radiological image quality.

  • MARCO ANTONIO PAULA DE SOUSA
  • TECNOLOGIAS APLICADAS A SISTEMAS DE PRODUÇÃO DE OVINOS DESLANADOS PARA ELEVAÇÃO DA PRODUTIVIDADE: SOBREALIMENTAÇÃO TARDIA NA GESTAÇÃO E TERMOGRAFIA INFRAVERMELHA NO PÓS-PARTO

  • Data: 08/11/2021
  • Mostrar Resumo
  • A ovinocultura vem demonstrando crescente aumento nos últimos anos. A valorização e demanda pela carne ovina tem estimulado a intensificação dos sistemas produtivos, para tanto é essenciais pesquisas sobre o uso de novas tecnologias, buscando o aumento do desempenho dos animais. Ovelhas apresentam alta exigência de energia no terço final de gestação, sendo que a subnutrição ou sobrealimentação durante a gestação podem afetar o desenvolvimento e produtividade da progênie. No momento do parto, ocorre uma intensa interação comportamental entre o neonato e a ovelha, e tal interação materno-filial é determinante para a sobrevivência do neonato. Soma-se a isso a necessidade de termorregulação dos cordeiros neonatos, devido à redução abrupta da temperatura envolvente, em decorrência do nascimento. Desta forma, o monitoramento dos mecanismos termorreguladores pode garantir a sobrevivência dos cordeiros, e sobre esse aspecto o uso da termografia por infravermelho tem se mostrado um método eficiente e simples para quantificar a perda de calor em animais adultos, mas pouco usada em neonatos. Já foi demostrado que estímulos durante os diferentes estágios gestacionais em ovelhas são capazes de afetar o desenvolvimento e o crescimento, a saúde, produção e reprodução da sua progênie após o nascimento. Assim, buscamos avaliar a influência de diferentes níveis de energia na alimentação de ovelhas da raça Morada Nova durante o terço final da gestação. Neste sentido, a tese foi dividida em capítulos, que contêm três manuscritos científicos. O capítulo denominado “Comportamento, vitalidade e homeotermia no pós-parto imediato de cordeiros deslanados nascidos de partos simples ou gemelares” (Capítulo 2, apresentado na íntegra) objetivou avaliar as diferenças de cordeiros deslanados, oriundos de partos simples ou de partos gemelares, quanto à expressão imediata de comportamentos inatos relacionados à vitalidade, aos perfis glicêmico e endócrino, bem como as características fenotípicas relacionadas à manutenção da homeotermia no pós-parto imediato; o capitulo denominado “Sobrealimentação materna no terço final de gestação afeta características puerperais e eficiência placentária em ovelhas deslanadas e melhora o desempenho dos cordeiros até o desmame” (Capitulo 3, apresentado na íntegra) objetivou avaliar a influência da oferta dietética diferencial de concentrado a ovelhas durante o terço final da gestação sobre características morfométricas placentárias e endócrinas maternas, além de seus efeitos na expressão comportamental de cordeiros no pós-parto imediato e no desempenho produtivo ao desmame;  o capitulo denominado “Sobrealimentação materna no terço final de gestação afeta características puerperais e eficiência placentária em ovelhas deslanadas e melhora o desempenho dos cordeiros até o desmame” (Capitulo 4, apresentado na íntegra) objetivou avaliar a sobrealimentação no terço final de gestação em ovelhas tropicalizadas: desempenho e crescimento da prole até o desmamem. O conhecimento gerado com este estudo ajudará na compreensão da programação fetal em ovinos naturalizados, bem como dos processos termorregulatórios em cordeiros deslanados neonatos, e na consolidação das mesmas como práticas de manejo para intensificação dos sistemas produtivos da ovinocultura brasileira.

  • ADRIANA XAVIER ALVES
  • Bem-estar da rã-touro (Lithobates catesbeianus) durante manejos de produção


  • Data: 29/10/2021
  • Mostrar Resumo
  • O presente estudo tem como objetivo avaliar os aspectos relacionados a fisiologia do estresse na rã-touro (Lithobates catesbeianus) durantes diferentes manejos de rotina realizados na produção comercial dessa espécie. Foram desenvolvidos quatro capítulos. O primeiro, introdução geral e revisão de literatura, apresenta alguns pontos importantes da ranicultura brasileira, informações sobre a rã-touro e uma revisão mais detalhada sobre o estresse em anfíbios e a liberação das catecolaminas e hormônios do eixo hipotálamo-hipófise-interrenal (HPI) e a influência disso no metabolismo energético desses animais. No segundo capítulo foi avaliado o estresse promovido por dois manejos de transporte (caixas com espuma úmida e caixas sem espuma) nas respostas hematológicas e bioquímica plasmática de rã-touro. As rãs recuperam a homeostase entre 12 e 24 horas após o transporte em ambas as condições avaliadas. O manejo em caixas com espuma não conferiu melhora significativa na condição dos animais e é mais laborioso, portanto, indica-se a utilização de caixas vazadas para o transporte de rãs-touro adultas. O terceiro capítulo apresenta evidências sobre como os métodos de insensibilização podem comprometer o bem-estar dos animais antes do abate. A comparação entre as técnicas de termonarcose e eletronarcose com animais mantidos nas baias e estressados por adensamento mostrou que a termonarcose, além de conferir mais estresse para a rã-touro, em relação a eletronarcose, pode superar, a depender da variável avaliada, a condição estressante de animais que foram contidos em sacos por mais de uma hora. Já o quarto capítulo apresenta a influência da frequência de troca de água sobre o desempenho de imagos criados em baias alagadas. Os resultados demonstraram um melhor consumo de ração nos tratamentos de uma e duas trocas diárias de água e fluxo contínuo de água, sendo esse último importante no processo de diluição da amônia total e, consequentemente, no melhor desenvolvimento das rãs. As informações apresentadas nesses capítulos podem contribuir para otimização de alguns manejos realizados ao longo da produção da rã-touro, possibilitando a manutenção do bem-estar desses animais.

  • HIGO ANDRADE ABE
  • Óleos de copaíba (Copaifera officinalis) e coco virgem (Coccus  nucifera) como nutracêuticos para tambaquis (Colossoma macropomum)
  • Data: 10/09/2021
  • Mostrar Resumo
  • O objetivo do presente estudo foi avaliar os efeitos nutracêuticos do oleorresina de copaíba (ORC) (Copaifera officinalis) e o óleo de coco virgem (OCV) (Cocccus nucifera L). Para tanto foram realizados três experimentos: No experimento 1 avaliou-se os efeitos in vitro do oleorresina de copaíba sobre os seguintes patógenos: fungo Saprolegnia parasitica (teste 1); bactérias gram negativas Aeromonas hydrophila, Aeromonas jandaei, Vibrio parahaemolyticus, Citrobacter sp., e Klebsiella pneumoniaeas bacterias gram positivas Micrococcus luteus e Streptococcus agalactiae; (teste 2), e protozoário Ichthyophthirius multifiliis (teste 3). Para todos os testes in vitro foi realizado uma emulsão de ORC, para facilitar a diluição em meio de cultura. Para os testes 1 e 3 foram utilizados nove tratamentos: (0; 50,6; 101,2; 202,4; 404,7; 607,1; 809,4 e 1011,8 mg ORC/litro) e Tween 80 na maior concentração utilizada. Para o teste 2 foram utilizados dez tratamentos (0, 50,6; 101,2, 202,36; 404,72; 607,08; 809,44 e 1011,8 mg/L), um controle positivo contendo 3mg/L de enrofloxacina e um contendo Tween 80 na maior concentração utilizada. Nesses experimentos in vitro, os halos de crescimento ou inibição foram medidos, e os experimentos tiveram duração de 96h para fungo, 24 h para bactérias e 4 h para o protozoário. No experimento 2, avaliou-se in vivo, os efeitos da suplementação de ORC e OCV em dietas para juvenis de Colossoma macropomum. Para esses experimentos foi realizado um delineamento em fatorial 4x2 sendo quatro níveis de ORC (0, 500, 2.000, 3.500 mg/kg de ração) e dois níveis de substituição de óleo de soja pelo óleo de coco (0 ou 50%) por 90 dias, onde foram avaliados mensalmente, os parâmetros zootécnicos e ao final do experimento, os parâmetros sanguíneos e histológicos.  No experimento 3, avaliou-se a resistência de C. macropomum suplementados com ORC e OCV contra a infecção por A. hydrophila, realizado em delineamento contendo 8 tratamentos: T1= ração sem suplementação; T2= 0% OCV + 500 mg ORC; T3= 0% OCV + 2.000 mg ORC; T4= 0% OCV + 3.500 mg ORC; T5= 50% OCV + 0 ORC; T6= 50% OCV + 500 mg ORC; T7= 50% OCV + 2.000 mg ORC; T8´= 50% OCV + 3.500 ORC, mais um controle injetado com solução de cloreto de sódio estéril, que foram alimentados por 90 dias. Após o período de suplementação, os peixes foram desafiados com Aeromonas hydrophila, na concentração de 1 x 106 UFC.g-1. O uso de ORC reduziu o crescimento micelial de S. parasitica quando em concentrações superiores a 50,6 mg/L, e teve efeito inibitório no crescimento de S. agalactiae, M. luteus e K. pneumoniae, a partir de 202,4 mg/L. Além disso, apresentou eficácia de 80% contra I. multifiliis em concentrações superiores a 101,2 mg ORC/litro. Dietas com diferentes concentrações de óleo, tiveram efeitos nos parâmetros zootécnicos durante 60 dias de suplementação. No entanto, após os 90 dias de suplementação dietária com óleos houve aumento do peso total e da biomassa dos peixes. Dietas contendo 2.000 e 3.500 de mg/kg ORC aumentaram o número de linfócitos e leucócitos totais, enquanto a dieta suplementada com 50% de OCV causou aumento do número de linfócitos. Houve efeito sinergico entre os óleos, com aumento de neutrófilos e monócitos. O aumento das concentrações de ORC resultou em alterações hepáticas que podem estar relacionados a um efeito hepatóxico. O aumento da suplementação conjunta do ORC e OCV tende a reduzir os sinais clínicos da aeromoniose, reduzindo assim, as taxas de mortalidade, apesar disso os efeitos da infecção por A. hydrophila causaram uma alta hemolização do sangue que impossibilitando as análises hematimétricas e leucocitárias. A avaliação histológica corroborou o observado pela taxa de mortalidade, onde em conjunto, os óleos reduziram os efeitos proporcionados pela infecção por A. hydrophila. Em conclusão, o ORC apresenta grande potencial para substituição de quimioterápicos na aquicultura, atuando contra importantes patógenos e sua aplicação na alimentação de C. macropomum promoveu, ao longo prazo, o aumento do desempenho, melhorias hematológicas e resistência a Aeromonas hydrophila quando incluída a 2000mg/kg ração em conjunto com OCV. Apesar disso, mais pesquisas devem ser realizadas para avaliar possíveis efeitos hepatotóxicos de altas concentrações de ORC e seus compostos isolados na alimentação de peixes.

  • JOEL ARTUR RODRIGUES DIAS
  • Efeito do uso isolado e do mix de bactérias probióticas suplementadas na dieta de juvenis de tambaqui Colossoma macropomum (Cuvier, 1818) e tilápia do Nilo Oreochromis niloticus (Linnaeus, 1758)
     
  • Data: 08/09/2021
  • Mostrar Resumo
  • A intensificação da piscicultura continental nacional exige o aprimoramento e desenvolvimento de estratégias produtivas sustentáveis para a produção de suas espécies, e o tambaqui e a tilápia se destacam no mercado nacional e do continente Latino Americano. Como medidas de incrementar o desempenho produtivo, sanitário e ambiental, o uso de probióticos possibilita a melhora na digestão dos animais, otimização das atividades enzimática, inibe o crescimento de agentes patogênicos e promove o equilíbrio da microflora intestinal, porém a maioria dos esforços se limita ao uso de monocepas para finalidades benéficas, sendo escassas as análises e os efeitos benéficos de uma combinação de probióticos em animais aquáticos. Desta forma, a presente pesquisa teve como objetivo avaliar os efeitos do uso de uma formulação probiótica multicepas (mix) durante a recria de juvenis de Colossoma macropomum e Oreochromis niloticus, sobre os parâmetros de desempenho zootécnico e sanitário. Para isso, foram utilizados 400 alevinos de tambaqui (1,13±0,01g 4,17±0,99cm) e 240 de tilápias (6,71±0,93g e 61,88±1,44mm) que foram alimentados durante 120 e 90 dias, respectivamente, com as dietas contendo a inclusão de: Enterococcus faecium (1) 2x106 UFC.g-1 na ração; Enterococcus faecium (2) 1x108 UFC.g-1 na ração; Bacillus cereus 2.8x106 UFC.g -1 na ração e uma formulação multicepas 1x108 UFC.g -1 na ração, além da dieta base. A formulação multicepas foi resultado da melhor resposta in vitro da interação entre as bactérias utilizadas de forma a não haver antagonismos. Durante o período de suplementação, o desempenho produtivo dos animais foi acompanhado a cada 30 dias, a partir de biometrias periódicas até o termino do experimento, e posteriormente foram realizadas as análises dos parâmetros microbiológicos, índice hepatossomático, esplenossomático, viscerossomático e hematológicos. Após a suplementação dietética, 90 tambaquis e 54 tilápias, foram infectados por injeção intraperitoneal de Aeromonas hydrophila e Streptococcus agalactiae na concentração de 1,8x108 UFC.g-1 de peixe e 1,7x107 UFC.g-1 de peixe, respectivamente, além de dois grupos controle, um positivo que representou animais do grupo isento de probiótico injetados com o patógeno e o negativo que foi injetado com solução estéril de NaCl (0,65%). As respostas inflamatórias com A. hydrophila e S. agalactiae foram monitoradas durante 96 h para registro dos sinais clínicos das doenças para intensidade infecciosa e mortalidade acumulada. Durante e ao término do período experimental, foram avaliados os parâmetros hematológicos para a contagem de células vermelhas, células totais, células leucocitárias, trombócitos e bioquímica sanguínea dos animais moribundos e sobreviventes. Para o tambaqui, o uso das dietas que continham os probióticos promoveu melhora no desempenho produtivo a partir dos 90 dias experimentais (p<0,05), e se mantiveram até o final de 120 dias para os parâmetros de comprimento total (15,30±0,29mm), comprimento padrão (12,20±0,45cm), peso (62,21±1,41g) e ganho de peso (27,54±0,70g). Resultado semelhante de desempenho foi observado nas tilápias, onde o uso de probióticos melhorou (p<0,05) o desempenho dos animais, com os espécimes do tratamento contendo B. cereus apresentaram o maior ganho de peso e ganho de comprimento, seguido do tratamento multicepas, com as maiores taxas de sobrevivência. Para as análises microbiológicas, tanto para o tambaqui como para a tilápia, o uso de multicepas probióticas (mix) na ração, apresentou isenção de bactérias potencialmente patogênicas no intestino dos animais ao final de 120 e 90 dias de produção, respectivamente. Em ambos os experimentos, o uso de probióticos na disponibilidade de cepa única ou mix, determinaram melhorias hematológicas. Para o tambaqui os tratamentos que continham B. cereus e mix determinaram melhoria no sistema imune com aumento nas contagens de trombócitos, linfócitos e neutrófilos. Para as tilápias alimentadas com as dietas contendo o mix probiótico, maiores valores para hematócrito (33,5±7,6 x106.µL-1), hemoglobina (13,8±1,3 g.dL-1) e proteína total (5,3±0,4 g.dL-1) foram observados. As dietas contendo os probióticos na ração influenciaram de forma positiva a resistência dos animais contra os patógenos A. hydrophila e S. agalactiae. Na infecção dos tambaquis com A. hydrophila, os tratamentos com B. cereus e mix na dieta obtiveram os menores registros de mortalidade (26 e 20%, respectivamente) e maiores concentrações (p<0,05) de leucócitos e trombócitos. Para as tilápias com S. agalactiae, as unidades que continham E. faecium (1), B. cereus e mix obtiveram as maiores taxas de sobrevivência após o período agudo infeccioso. Dessa forma, com os resultados alcançados com a pesquisa, o uso de probióticos na administração em cepa única e multicepas mix, melhoraram os parâmetros produtivos durante 120 e 90 dias, na produção de tambaquis e tilápias, respectivamente, e sanitários contra as infecções agudas e patogênicas. Ressalta-se, que as respostas de desempenho e profiláticas nos tratamentos que continham a inclusão de multicepas mix, foram capazes de promover efeitos promissores aos animais confinados, devido a um efeito sinérgico entre as bactérias utilizadas, mesmo em concentrações menores que às recomendadas de cada cepa para uso na aquicultura. Além disso, a formulação multicepas promoveu uma modulação na microbiota intestinal com ausência de cepas potencialmente patogênicas nos animais suplementados.

  • LUANA DE NAZARE DOS ANJOS AIRES
  • Determinação do coeficiente de digestibilidade aparente do concentrado proteico de soja para formas jovens de pirarucu (Arapaima gigas)

  • Data: 06/09/2021
  • Mostrar Resumo
  • O pirarucu (Arapaima gigas) é um peixe carnívoro nativo da bacia amazônica, possui características favoráveis para a criação em cativeiro, tais como: rápido crescimento, podendo atingir até 12 kg no primeiro ano de criação; tem respiração aérea, sendo resistente a baixos níveis de oxigênio dissolvido na água; pode ser treinado a receber rações comerciais; possui alto rendimento de filé, que tem elevado valor no mercado. Contudo, é uma espécie de elevada exigência proteica, e as principais fontes utilizadas nas formulações de rações completas são de origem animal, principalmente farinha de peixe, insumo finito e de elevado valor comercial. Portanto, torna-se essencial buscar fontes proteicas alternativas a esse insumo, como o Concentrado Proteico de Soja (CPS), que apresenta elevado teor proteico e baixa concentração de fatores antinutricionais devido ao seu processamento. Existem várias avaliações feitas com o farelo de soja, mas pouco se conhece sobre a qualidade nutricional do CPS para um carnívoro como o pirarucu. Portanto, este estudo teve como objetivo determinar os Coeficientes de Digestibilidade Aparente (CDAs) da Matéria Seca (MS), da Proteína Bruta (PB), e da Energia Bruta (EB) do CPS para duas classes de peso do pirarucu (I e II) e comparar com o CDA do farelo de soja (FS) para peixes da classe II. Os CDAs foram determinados pelo método indireto, utilizando óxido de cromo como marcador inerte. Foram utilizados 18 peixes por caixa para a classe I (217,68 ± 5,51) e 6 peixes por caixa para a classe II (624,16 ± 2,75). Houve diferenças significativas entre as duas classes no CDA de MS e EB do CPS, cujo aproveitamento foi menor para os indivíduos da classe I (68,87% ± 0,67; 72,05% ± 5,86, respectivamente). Não foi observada diferença para o CDA da PB do CPS (P > 0,05) entre as classes de peso. A comparação feita entre os CDAs da MS, PB, e EB do CPS com FS para pirarucus da classe II, mostra que não houve diferença (P > 0,05) no CDA MS e EB. Por outro lado, a proteína do CPS foi melhor aproveitada (99,22 %) pelos animais da classe II (P < 0,05). Diante disso, o estudo evidenciou que pirarucus das classes de peso I e II apresentaram elevada utilização da proteína do CPS, sendo um bom indicativo para a inclusão deste ingrediente em rações específicas para juvenis de pirarucu, viabilizando formulações eficientes e de menor poder poluente, que possa proporcionar o bem-estar da espécie e a sustentabilidade da sua criação.

  • ISAMAIRA COSTA E SILVA
  • SUBSTITUIÇÃO DA FARINHA DE PEIXE PELA DA FARINHA DE INSETO (Nauphoeta cinérea) EM DIETAS PARA PEIXES ORNAMENTAIS AMAZÔNICOS: ACARÁ BANDEIRA (Pterophyllum scalare) (SCHULTZE, 1823) E ACARÁ SEVERO (Heros severus) (HECKEL, 1840)

  • Data: 03/09/2021
  • Mostrar Resumo
  • Os insetos vêm ganhando destaque nos últimos anos como potencial fonte proteica para nutrição animal, devido as qualidades nutricionais, alta eficiência de bioconversão, viabilidade de aumento da produção, tecnologia de processamento disponível e baixo requisitos em terra, energia e água. Atualmente aplicação mais viável é na nutrição no mercado PET, especialmente em peixes ornamentais, devido ao elevado preço de comercialização das farinhas de insetos. Os insetos estão presente na alimentação natural dos peixes ornamentais amazônico, acará bandeira (Pterophyllum scalare) e acará severo (Heros severus). Diante disso, o objetivo do estudo foi determinar o potencial de inclusão da farinha de inseto (Nauphoeta cinérea) em substituição a farinha de peixes em dietas para alevinos de acará bandeira e acará severo. Dois experimento, um para cada espécie foi conduzido em delineamento inteiramente casualizado, com cinco tratamentos e quatro repetições. Cinco dietas isoprotéica (40,03 ± 0,08% de proteína bruta) e isoenergética (4405,37 ± 41,81 kcal/kg de energia bruta) foram preparadas para conter 0, 5, 10, 15 e 20% de farinha de inseto, valores referentes aos níveis de substituição de 0, 25, 50, 75 e 100% da farinha de peixe pela farinha de inseto. As dietas foram oferecidas quatro vezes ao dia, até a saciedade aparente, por 45 dias em ambos os experimentos. Os alevinos foram analisados enquanto desempenho e a histomorfometria do intestino. Os dados de desempenho do acará bandeira apresentaram diferenças significativas e os melhores resultados de peso final, ganho de peso, comprimento final, ganho de comprimento e taxa de crescimento específica para peso e comprimento, foram observados para peixes alimentados com dietas contendo 0 e 25% de farinha de inseto. O consumo da dieta, a taxa de sobrevivência e a uniformidade do lote, por peso e por comprimento, não apresentaram diferenças significativas. As análises histomorfométricas do intestino não revelaram nenhum efeito adverso das dietas sobre a altura, espessura e perímetro das vilosidades, assim como na espessura da túnica muscular e número de células caliciformes por vilosidade dos indivíduos avaliados. Já os dados do acará severo, revelarão efeito quadrático negativo para as variáveis comprimento final, ganho de comprimento, peso final, ganho de peso e taxa de crescimento especifico para crescimento e peso com o aumento do nível de substituição nas dietas, com valores ótimos estimado em 18,17%, 18,17%, 12,95 %, 12,95%, 20,00% e 12,50%, respectivamente. O consumo, a taxa de sobrevivência e a uniformidade do lote para comprimento e peso não foram afetados pelos tratamento dietéticos. Em relação a histomorfometria não houve efeito significativo para espessura da túnica. Porém, foi observado um efeito quadrático negativo com aumento do nível substituição no número das células caliciformes por vilosidade, altura, espessura e perímetro das vilosidades, indicando valores ótimos estimados em 35,25%, 45,75%, 43,75% e 44,60%, respectivamente.

  • GEISY CORREA DE OLIVEIRA
  • ENRIQUECIMENTO DE Artêmia sp. COM ÓLEO DE COCO VIRGEM PARA

    ALIMENTAÇÃO DE PÓS-LARVAS DE PIAU (Leporinus macrocephalus)

  • Orientador : CARLOS ALBERTO MARTINS CORDEIRO
  • Data: 31/08/2021
  • Mostrar Resumo
  • O óleo de coco virgem (VCO) (Coccus nucifera L.) é um alimento funcional bastante utilizado na industria cosmética, farmaceutica e alimentar, devido as propriedades benéficas encontradas na sua constituição como os ácidos graxos de cadeia média (AGCM) e por ser uma fonte lipidica de rápida absorção pelo organismo. O ácido laurico é um dos principais AGCM encontrado no óleo de coco chegando a constituir cerca de 50% da sua composição. O ácido laurico contém propriedades contra bacterias patogênicas através da ação da monolaurina quando convertida no organismo, e para a criação de organismos aquáticos pode ser tornar uma ferramenta que auxilie no desempenho como fonte de energia e também com ação na imunologia dos animais. O presente trabalho teve como objetivo avaliar os efeitos da alimentação com náuplios de Artêmia sp enriquecidos com VCO durante a larvicultura do Piau (Leporinus macrocephalus). Para isso, foi realizado um delineamento inteiramente casualizado com cinco tratamentos em cinco repetições, que consistiu na alimentação com Artêmias sp. enriquecidas nas seguintes quantidades: T1: 0 µL; T2: 40 µL; T3: 60 µL; T4: 80 µL e T5: 100 µL de óleo de coco virgem nos  horários (8:00; 11:00; 14:00 e às 17:00 horas), durante 20 dias. No início e ao final do experimento, as larvas foram medidas e pesadas para o cálculo das variáveis de desempenho produtivo. Posteriormente, 15 larvas de cada tratamento foram distribuídas em recipientes de 1litro (com 5 larvas por recipiente) para avaliação do desafio bacteriano, com a inserção de cepas de bactéria Aeromonas hydrophila, crescida em meio agar triptona de soja (TSA), durante 96 horas. Os resultados mostraram que o desempenho produtivo apresentou diferença significativa para os parâmetros de ganho em biomassa, uniformidade e sobrevivência. A análise morfohistológica mostrou melhores resultados apenas nos tratamentos sem adição de VCO para altura do vilo e para altura total do vilo, ocorrendo também diferença para largura do vilo para o tratamento com 100 µL de VCO. Na análise microbiologica não foram encontrada diferença entre os tratamentos testados. A análise estatística foi feita pelo teste Shapiro-Wilk e pelo teste de Levene´s para verificação da normalidade e homogeneidade dos dados, respectivamente. Seguida da análise de variância (ANOVA) e com às médias com F significativo comparadas pelo teste de Tukey a 5 % de probabilidade. Em conclusão, o VCO pode auxiliar durante a fase pós-larval de L. macrocephalus ao garantir uma melhoria em alguns indices zootécnicos, além de estimular o aumento da largura dos vilos, este parametro pode influenciar no aumento da area de contato do intestino melhorando a absorção de nutrientes e ajudando no crescimento do animal.

  • DAERCIO JOSE DE MACEDO RIBEIRO PAIXAO
  • RESTRIÇÃO ALIMENTAR PROGRAMADA NA PRODUÇÃO DE MATRINXÃ Brycon amazonicus EM TANQUES-REDE

  • Data: 31/08/2021
  • Mostrar Resumo
  • Este estudo teve como objetivo avaliar o efeito da restrição alimentar programada no desempenho zootécnico, composição centesimal, rendimento corporal, parâmetros hematológicos e custo de produção de matrinxã Brycon amazonicus em tanques-rede. Um total de 4.500 juvenis com peso médio de 11,5±2,3 g foram distribuídos em 15 tanques-rede de 1 m³, onde foram testados cinco protocolos de alimentação durante 75 dias: alimentação contínua (75A/0R); alimentação por 68 dias e restrição alimentar por 7 dias contínuos (68A/7R); alimentação por 61 dias e restrição alimentar por 14 dias contínuos (61A/14R); alimentação por 54 dias e restrição alimentar por 21 dias contínuos (54A/21R); e alimentação por 47 dias e restrição alimentar por 28 dias contínuos (47A/28R). Em todos os tratamentos, os peixes foram alimentados com rações contendo 36% e 32% de proteína bruta, passaram por um período de aclimatação de 10 dias e realimentação de 30 dias. A restrição alimentar não influenciou significativamente a sobrevivência, a conversão alimentar aparente e a eficiência alimentar de juvenis de matrinxã. Os peixes expostos a menores períodos de jejum (75A/0R, 68A/7R e 61A/14R) apresentaram os maiores valores de peso e comprimento finais, ganho de peso e comprimento, taxa de crescimento específico e ingestão diária de ração. A restrição alimentar não exerceu influência nos valores de umidade, lipídios, proteínas e cinzas, bem como não houve diferença significativa na glicose, hematócrito, eritrócitos, proteínas plasmáticas totais e na contagem diferencial de leucócitos e trombócitos entre os protocolos testados. Os peixes do tratamento de maior restrição alimentar (47A/28R) apresentaram um rendimento do corte “peixe eviscerado sem cabeça” menor quando comparado aos demais tratamentos. Desta forma, recomenda-se a restrição alimentar programada de 14 dias ininterruptos durante os primeiros 75 dias de criação de matrinxã em tanques-rede, o que proporcionaria uma economia de 17,8% no custo de produção em relação ao manejo convencional, sem privação alimentar.

  • DEYVID DE MENEZES MELO
  • A IDADE DE PODA AFETA AS CARACTERÍSTICAS AGRONÔMICAS E PRODUTIVAS DE PLANTAS DE MANDIOCA CULTIVADAS EM CLIMA TROPICAL

  • Data: 30/08/2021
  • Mostrar Resumo
  • O manejo agronômico da mandioca (Manihot esculenta Crantz), como a poda da parte aérea ao longo do cultivo, pode possibilitar incrementos em produtividade da cultura durante o ciclo produtivo. A biomassa oriunda desse manejo pode ser um alimento alternativo para ruminantes. Neste sentido objetivou-se com este trabalho avaliar as características agronômicas, produtivas das partes aéreas e das raízes da mandioca, (Manihot esculenta Crantz) em função da idade de poda. Foi utilizado um delineamento em blocos casualizados, com seis idades de poda (6; 7; 8; 9; 10 e 11 meses após o plantio) da parte aérea de plantas de mandioca, com quatro repetições. A coleta dos dados foi realizada em dois períodos, definidos como primeira e segunda colheita. Foi determinado em todos os componentes obtidos na primeira e segunda colheita o peso das folhas, pecíolo, caule, raiz e poda, expresso em matéria natural (MN) ou matéria seca (MS). Além disso determinação dos parâmetros morfológicos e de produtividade foram expressos tanto na MN como MS. O peso seco foi determinado em estufa de circulação forçada de ar a 55 ºC por 72 horas. Foi observado um ajuste cúbico (P<0,01) na altura e linear para o diâmetro (P<0,01) do caule de acordo com a idade de desenvolvimento das plantas. O componente raiz aumentou linearmente (P=0,002) com as idades de desenvolvimento das plantas. Na avaliação morfométricas no segundo ciclo de colheita, ou seja, na rebrota da parte aérea, foi observado efeito cúbico (P<0,05) na altura (P<0,01), diâmetro do caule (P<0,01), número de brotações (P=0,02), número de ramificações (P<0,01) e número de folhas. Quanto a produtividades da lavoura em ton MN ha-1, observou-se efeito quadrático na poda (P<0,01) e planta inteira (P<0,04). Foi observada correlação positiva (r>0,80) na produção de raiz (em kg de MS planta-1) com a produção de planta inteira (em kg de MS planta-1), produtividade de raiz (ton MS ha-1) e produtividade da planta inteira (ton MS ha-1). A porcentagem de poda apresentou uma correlação negativa (r>0,80) com a porcentagem de raiz. Idades de poda da parte aérea da mandioca possibilitam ganhos em produtividade da parte aérea sem comprometer a produtividade de raízes.

  • SUANE CRISTINA DO NASCIMENTO MATOS
  • DIVERSIDADE ÍCTICA EM UMA COMUNIDADE DOS CAMPOS ALAGADOS, NORDESTE PARAENSE, AMAZÔNIA COSTEIRA

  • Data: 27/08/2021
  • Mostrar Resumo
  • O objetivo deste estudo foi caracterizar a composição da diversidade da ictiofauna dos campos alagados da comunidade da Chapada e do estuário do rio Tracuateua-Quatipuru. O estudo foi realizado no município de Tracuateua, localizado no Nordeste paraense, sendo o lócus da pesquisa na região dos campos naturais alagados, na comunidade da Chapada. Foram selecionados três pontos de amostragem, sendo dois dentro dos campos alagados e um na região estuarina do rio Tracuateua-Quatipuru. As coletas se deram entre os meses de setembro de 2019 a setembro de 2020 para contemplar os períodos seco e chuvoso. Foram coletados 1.293 indivíduos distribuídos em 14 ordens, 26 famílias e 44 espécies. As ordens mais abundantes foram Characiformes (31,4%), Siluriformes (29%) e Perciformes (16,6%). A maior densidade de indivíduos foi registrada no período chuvoso (N=662), e o maior número de espécies foi registrada no ponto 3 (S=27). O índice de Shannon foi maior no ponto 3 durante o período seco (H’=2,3006). No entanto, a maior riqueza foi registrada nesse ponto durante o período chuvoso (d=3,5794). Conclui-se que o trabalho apresenta informações importantes sobre a ictiofauna local capaz de balizar futuras ações de manejo sustentável dos recursos naturais da região.

  • CHARLES SAMUEL MORAES FERREIRA
  • Genética molecular como ferramenta para auxiliar o manejo reprodutivo e a implantação de centros de reprodução de Tambaqui (Colossoma macropomum Cuvier, 1818) no Brasil

  • Data: 25/08/2021
  • Mostrar Resumo
  • Este trabalho avaliou a diversidade genética em populações cultivadas de Tambaqui, um peixe nativo de grande relevância na piscicultura nacional. Nossos resultados evidenciam que a baixa diversidade genética em populações de piscicultura de Tambaqui já vem sendo reportada há pelo menos duas décadas, consequência do processo de domesticação, já que a maioria dos peixes utilizados para fundar o plantel de reprodutores dos centros de reprodução de Tambaqui no Brasil, foram provenientes do estoque do Centro de Pesquisas Ictiológicas Rodolpho von Ihering, DNOCS, Pentecoste, Estado do Ceará, desenvolvido a partir de 74 alevinos capturados no alto Amazonas, Iquitos, Peru, em 1972. Soma-se a essa origem comum, a ausência de manejos genéticos eficientes nos centros de reprodução. Analisamos a influência do repovoamento com indivíduos de centros de reprodução de diferentes regiões do Brasil, aliado a cruzamentos não endogâmicos, sobre a diversidade genética de um centro de reprodução de Tambaqui. Para isso, foram feitas análises comparativas com base em sequências da Região Controle do DNA mitocondrial de espécimes de populações naturais e cativas. Recuperamos apenas dois haplótipos nas três populações do centro de reprodução (97 amostras), enquanto nas populações selvagens (35 amostras), encontramos 31 haplótipos. Um dos haplótipos recuperados nas populações deste centro foi reportado como sendo o único presente em pisciculturas do estado de Rondônia, Piauí, Amapá e Pará. Concluímos que a estratégia de repovoamento, mesmo que aliada a cruzamentos não endogâmicos, não se mostrou eficiente, visto que a diversidade genética continua em níveis críticos nas amostras do centro de reprodução analisado. Levantamos o questionamento sobre a relação dos baixos índices de diversidade genética com a queda na produção desta espécie que vem ocorrendo há pelo menos seis anos em uma média anual aproximada de 6,4 toneladas. Deste modo, é urgente o repovoamento dos centros de reprodução com indivíduos de ambiente natural, especialmente de áreas de hot spots de diversidade e a adoção de manejo genético dos reprodutores, no sentido de renovar e manter melhores índices de variabilidade, garantindo o potencial adaptativo das populações. Por fim, geramos uma cartilha elencando nossos achados de forma didática com o intuito de popularizá-los principalmente entre os produtores, contribuindo desta maneira para a adoção de boas práticas de manejos genéticos reprodutivos nos centros de reprodução de Tambaqui.

  • CARLOS EDUARDO PUGA DO NASCIMENTO
  • AVALIAÇÃO NEUROLÓGICA E CARDÍACA DO TAMBAQUI Colossoma macropomum (Cuvier, 1818) EXPOSTO AO ÓLEO ESSENCIAL DE CITRONELA Cymbopogon nardus (L.) Rendle.

  • Data: 05/05/2021
  • Mostrar Resumo
  • Os anestésicos são frequentemente utilizados em pisciculturas para reduzir a motilidade durante a manipulação e atenuar o estresse. Entre os naturais, destaca-se o óleo essencial de citronela. Esse óleo apresenta em sua composição elevadas concentrações de citronelal, geraniol e citronelol. Os óleos essenciais (OE) de plantas têm sido testados como anestésicos, entretanto, ferramentas mais adequadas para avaliar seus efeitos anestésicos precisam ser utilizadas. A avaliação eletrofisiológica é recomendada para que a eficácia do ponto de vista neurofisiológico seja atestada. Assim, objetivou-se avaliar a eficiência do OE de citronela em juvenis de tambaqui (Colossoma macropomum), através da verificação da capacidade de determinar a depressão neuronal central e os impactos sobre a função cardíaca. Para caracterização das respostas eletrofisiológicas, foram utilizados 36 juvenis de tambaqui (28,9 ± 4,5g; 12 ± 2 cm), sendo 18 animais para cada registro (eletrocardiograma – ECG e eletroencefalograma – EEG) distribuídos da seguinte forma: Grupo controle EEG (n=9) com animais em água livre de anestésico  submetidos a  5 minutos de registro; Grupo para o registro de EEG (n=9), exposto ao banho com OE de citronela por 5 minutos, na concentração de 1200 μL.L–1 e subsequente recuperação (5 minutos); Grupo controle ECG (n=9) com animais em água livre de anestésico  submetidos a  5 minutos de registro e Grupo para registro de ECG (n=9), exposto ao banho com OE de citronela durante 5 minutos, na concentração de 1200 μL.L–1 e subsequente recuperação (5 minutos). O ECG demostrou que o óleo foi capaz de promover depressão e recuperação gradativa da função cardíaca, porém, em alguns momentos, observou-se presença de ondas P isoladas, sem o correspondente complexo QRS. A duração do complexo QRS aumentou nos peixes expostos a citronela. Durante o contato com a citronela, pode se observar diminuição tempo-dependente da amplitude dos traçados de EEG em relação ao controle, verificando-se que o contato com a droga diminui a diferença entre os potenciais registrados com respectiva depressão neuronal central. Em conclusão, a concentração de OECN a 1200 μL.L-1 promoveu alterações no registro eletrocardiográfico, verificando-se depressão reversível da função cardíaca, com presença de arritmia transitória durante a indução. A depressão do SNC verificada no EEG corrobora a eficácia desse óleo como produto a ser utilizado para anestesia geral rápida de peixes.

  • LUCIENE DINIZ DOS SANTOS
  • RECUPERAÇÃO DA HOMEOSTASE DE JUVENIS DE PACAMÃ (Lophiosilurus alexandri) EM DIFERENTES SALINIDADES DA ÁGUA APÓS ESTRESSE DE CAPTURA


  • Data: 31/03/2021
  • Mostrar Resumo
  • O presente objetivou-se avaliar a recuperação de juvenis de pacamã (Lophiosilurus alexandri) em diferentes salinidades de água após estresse. Foram testadas três concentrações de NaCl (0, 3 e 6g L-1) em cinco diferentes tempos (0,5, 3, 6, 12 e 24h) e um tratamento controle – peixes em homeostase.  Após o estresse de captura (15min), exceto nos peixes do tratamento controle, os juvenis foram alocados nos tanques com as respectivas salinidades, e sangue coletado nos diferentes tempos. Entre as variáveis bioquímicas, não houve interação (P>0,05) entre as concentrações testadas e os tempos avaliados após o estímulo de estresse na relação Albumina/Globulina e nos triglicerídeos, em relação ao controle. Já as variáveis glicose, lactato, proteínas totais, albumina, globulinas e colesterol, apresentaram efeitos significativos (P<0,05) das concentrações de sal, dos tempos de coleta e da interação, quando comparadas ao controle. Em relação ao controle, juvenis avaliados nos tempos 0,5 e 3h após o estresse apresentaram maiores níveis de glicose nas três concentrações avaliadas. Já os peixes avaliados 6h após o estresse apresentaram maiores níveis de glicose apenas nas concentrações 0 e 6 g L-1, em relação ao tratamento controle. Os níveis de lactato apresentaram incremento significativo (P<0,05) no tempo de 0,5h nas três concentrações de NaCl testadas e no tempo 3h na concentração 3g L-1, em relação ao controle. Os juvenis avaliados nos tempos 0,5h e 3h após o estresse apresentaram maiores níveis de proteínas totais nas concentrações 6g L-1 e 3g L-1, respectivamente. As concentrações de albumina dos juvenis avaliados, apresentaram diferença significativa (P<0,05) somente na concentração 6g L-1 após 3h do estímulo de estresse aplicado. Comprados ao grupo controle, os animais estudados no tempo de 0,5h após estresse apresentaram níveis maiores de globulinas na concentração de 6g L-1. Já os níveis de colesterol apresentaram incremento significativo quando comparado ao controle na concentração 6g L-1 de NaCl, nos tempos 3h (P<0,05) e 6h (P<0,01), e na concentração 0g L-1 em 12h (P<0,01) após o estresse. No eritrograma, hemoglobina, VCM, HCM e CHCM não apresentaram efeitos significativos (P>0,05) entre as concentrações de NaCl e os tempos avaliados, demonstraram efeito (P<0,05) somente a contagem de eritrócitos e o hematócrito. Houve uma diminuição do hematócrito dos peixes avaliados 6 e 12h após o estresse. No entanto, 24 horas após o estresse o hematócrito reestabeleceu a valores similares ao do controle. O número de eritrócitos aumentou significativamente 0,5h após a captura e reestabeleceu 6 e 12h após o estresse.

  • GERLANE NUNES NORONHA
  • Caracterização do microbioma ruminal de búfalos de água (Bubalus bubalis) mantidos em diferentes ecossistemas na Amazônia Oriental

  • Data: 11/03/2021
  • Mostrar Resumo
  • A elevada eficiência da fermentação ruminal é uma das principais formas para maximizar a produção de ruminantes, por isso é importante conhecer o perfil microbiano do rúmen, além das condições que favorecem o crescimento dessa comunidade. Entretanto, não há relatos que descrevam a composição microbiana em búfalos na Amazônia. O estudo foi realizado com o objetivo de caracterizar o microbioma de búfalos na Amazônia Oriental, nos períodos seco e chuvoso, de agosto de 2018 a janeiro de 2019, nos ecossistemas: Baixo Amazonas (BA), Continente do Pará (PA), Ilha do Marajó (IM) e Tomé-Açú (TA) (sistema de confinamento). Foram usados 71 búfalos machos, idade de 26 a 36 meses, mestiços Murrah x Mediterrâneo, peso médio de 432 kg no final do período chuvoso e 409 kg no final do período seco, alimentados com pastagens nativas e cultivadas. No sistema de confinamento a alimentação era composta por silagem de sorgo, farelo de soja, pré-mistura sorgo úmido e ração comercial. Foram coletadas amostras da dieta de cada ecossistema para análise bromatológica. As coletas do conteúdo ruminal foram realizadas em matadouros frigoríficos, com rúmen totalmente esvaziado e homogeneizado, as frações sólidas e líquidas foram separadas e o pH ruminal foi mensurado. O DNA foi extraído das amostras do rúmen e então sequenciado, utilizando-se o sequencimaneto com enzima de restrição reduzida. A composição taxonômica revelou grande similaridade entre os ecossistemas. Em nível de filo, houve predominância dos Bacteroidetes e Firmicutes. Dentre as arqueas, o filo Euryarchaeota foi mais abundante. A Prevotellaceae, Lachnospiraceae e Acidaminococcaceae foram as famílias bacterianas de maior abundância. Foram identificados 61 gêneros na microbiota analisada, entre os domínios bactérias e arqueas. 23 gêneros bacterianos diferiram significativamente (P< 0,001) entre o confinamento e os demais ecossistemas, como, Bacillus, Ruminococcus e Bacteroides tiveram menor abundância em amostras do sistema de Tomé-Açu. Dentre as Archaeas, o gênero Methanomicrobium apresentou menor abundância relativa em Tomé-Açu, enquanto Methanosarcina foi mais abundante.Quatro gêneros bacterianos diferiram entre os períodos do ano e o sistema de confinamento, dentre eles, Bacillus e Clostridium foram menos abundantes no confinamento. Methanomicrobium foi a arquea mais abundante no período chuvoso, enquanto a Methanosarcina teve abundância elevada no confinamento. Observou-se 27 gêneros bacterianos e 2 arqueais com diferenças significativas entre as frações sólida e líquida do conteúdo ruminal. Doze gêneros foram mais abundantes na fração líquida, dentre eles Bacillus, Ruminobacter e Prevotella. Quinze gêneros tiveram maiores abundâncias relativas na fração sólida, dentre eles, Clostridium e Eubacterium. Methanosarcina foi o gênero de arquea mais abundante na fração líquida e Methanosbrevibacter mais abundante na fração sólida. Foram encontradas diferenças significativas entre os micro-organismos nas diferentes dietas,  períodos do ano e frações do conteúdo ruminal.

  • LAURENA SILVA RODRIGUES
  •  

     

    Variação sazonal da composição lipídica e mineral de diferentes tecidos de búfalo em ecossistemas de criação da Amazônia Oriental

  • Data: 26/02/2021
  • Mostrar Resumo
  • O objetivo da pesquisa foi avaliar a influência de diferentes ecossistemas de produção, três em pastagens nativas e cultivadas, em duas épocas do ano (períodos seco e chuvoso), e um em confinamento, na Amazônia Oriental nos níveis de colesterol, vitâmeros da vitamina E, β-caroteno, ácidos graxos e minerais do músculo, fígado e tecido adiposo de búfalos criados nesses ecossistemas. Foram utilizados 12 búfalos machos, com idade entre 24 e 36 meses, abatidos em matadouros frigoríficos comerciais, em cada um dos ecossistemas considerados: Ilha do Marajó (Soure); Baixo Amazonas (Santarém); Continente (Nova Timboteua); e em ecossistema de confinamento (Tomé-açú), Pará, Brasil. Foram utilizadas amostras de músculo, fígado e tecido adiposo, as quais foram armazenadas e congeladas, até a liofilização. Em seguida, enviadas ao Instituto Superior de Agronomia e à Faculdade de Medicina Veterinária da Universidade de Lisboa, onde se realizaram as análises de vitaminas, pelo método de HPLC, ácidos graxos, através do método de cromatografia gasosa de FAME, e minerais, a partir de leituras de espectrometria de emissão óptica de plasma, acoplado indutivamente (ICPOES). Os ecossistemas, o período do ano e o local de estudo, influenciaram significativamente em grande parte dos resultados. Houve diferenças significativas nos teores de lipídios totais e colesterol total de músculo e fígado de búfalos criados nos ecossistemas amazônicos. Os teores de alfa e gama tocoferol e gama tocotrienol no músculo e fígado foram influenciados significativamente pelos ecossistemas estudados. O perfil de ácidos graxos encontrados no músculo e fígado foram significativamente diferentes. Quanto aos teores de minerais, o Na, K, Ca, Mg, P, S, Cu, Zn, Fe, Mn e Ba, diferiram significativamente no músculo, porém no fígado, todos, exceto o Mn e Ba, diferiram entre si. O trabalho de pesquisa demonstrou que os diferentes ecossistemas estudados influenciaram significativamente nos resultados de colesterol e vitaminas, perfil de ácidos graxos e minerais de músculo e tecido hepático de búfalos.

  • WANIA MENDONÇA DOS SANTOS
  • FATORES DETERMINANTES DA PRODUÇÃO E DO CICLO DE PREÇOS DA PECUÁRIA DE CORTE NO ESTADO DO PARÁ

  • Data: 24/02/2021
  • Mostrar Resumo
  • O trabalho analisa os fatores determinantes da produção e do ciclo de preços da pecuária de corte no estado do Pará, no período de 1995 a 2019. Esse tipo de análise é importante para orientar decisões de pecuaristas, agroindústria frigorífica e demais atores da cadeia produtiva da pecuária de corte, relacionadas à negociação do boi e as influências que as oscilações de preços causam na comercialização e desempenho deste segmento econômico. Foram utilizados dados de séries temporais obtidos em diversas fontes e submetidos à análise de regressão múltipla. Para a análise de preços, utilizou-se o modelo clássico de séries temporais com a separação dos índices sazonais e cíclicos, com base na média móvel centrada em doze meses. Os resultados obtidos mostram que as cotações de boi gordo apresentaram tendência de alta, no período de janeiro de 1995 a dezembro de 2019. Foi identificada sazonalidade anual nos preços, com redução dos preços no primeiro semestre e elevação no segundo semestre do ano, correspondendo a safra e entressafra do boi gordo, respectivamente, comportamento determinado pela capacidade de suporte das pastagens, em função das condições climáticas que ocorrem ao longo do ano. O preço do boi gordo apresentou índices sazonais inferiores  a 100, entre fevereiro e agosto, com elevações acima de 100, de setembro a janeiro. O pico de preços altos ocorreu no mês de novembro e o nível mais baixo, em junho. Foi possível observar a existência de três ciclos pecuários com duração média de sete anos. Quanto aos fatores que contribuíram para o desenvolvimento e crescimento da pecuária no estado, constatou-se correlação positiva entre o desmatamento e o crescimento do rebanho bovino no recorte temporal analisado. Da mesma forma, também houve correlação positiva na política de crédito rural e o rebanho bovino, considerando-se este fator como forte impulsionador para o desenvolvimento da pecuária bovina, ao fornecer subsídios para financiamento de projetos pecuários. A criação, no ano de 2002, da Agência de Defesa do Estado do Pará (ADEPARÁ), exerceu efeito positivo sobre o aumento da produção de bovinos, representando avanço significativo na esfera institucional, o que contribuiu para o controle sanitário animal, garantiu a comercialização no mercado interno, nacional e internacional e abertura de novas oportunidades de mercado de exportação. Esses resultados contribuem para ampliar a compreensão da dinâmica desse importante mercado do agronegócio paraense.

2020
Descrição
  • BRUNO HENRIQUE DOS SANTOS MORAIS
  • AVALIAÇÃO DA ESTABILIDADE DE LINGUIÇAS FRESCAIS DE CAITITU (Pecari tajacu) ELABORADAS COM FIBRAS ALIMENTARES E ACONDICIONADAS SOB ATMOSFERA MODIFICADA

  • Data: 22/12/2020
  • Mostrar Resumo
  • O consumo da carne de animais domésticos e silvestres estão diretamente relacionados à aspectos sociais, econômicos e culturais. Dentre os derivados cárneos destaca-se a linguiça por ser um dos embutidos mais consumidos no Brasil devido a sua facilidade de elaboração, no entanto, necessita de certo conhecimento técnico. Nesse sentido, a utilização de carne de animais silvestres, em especial o caititu, agrega valor comercial ao produto, já que é uma carne pouco explorada e com características sensoriais específicas. O objetivo deste estudo foi elaborar linguiça do tipo frescal com atmosfera modificada, com apelo funcional, de carne de caititu (P. tajacu), como alternativa para a utilização de fauna silvestre nativa com potencial zootécnico. Para a elaboração de linguiça frescal, quatro carcaças de caititu foram doadas do criatório científico de caititus da Embrapa Amazônia Oriental. Os animais, duas fêmeas e dois machos, possuíam entre 18 a 21 meses. Para a elaboração da linguiça frescal, foi utilizada uma formulação padrão (sem fibras) e quatro formulações contendo diferentes concentrações de fibras de aveia, trigo e mandioca. Foram realizadas análises físico-químicas, microbiológicas, sensoriais e estatística no pernil e paleta de caititu e, também, nas amostras de linguiça frescal. Foi observado que nos resultados microbiológicos encontrados estavam dentro do que estabelece a legislação vigente no que diz respeito à carnes e produtos cárneos. Em relação à composição centesimal, houve diferença significativa entre as amostras, sendo o teor de umidade variando entre 56,02 e 58,19%. Os testes de aceitação e intenção de compra revelaram que as amostras de linguiças com formulação padrão (FP) e adicionada de fibra de mandioca (FM) foram as mais aceitas entre os consumidores. Os resultados mostram que a linguiça de caititu apresenta potencial de comercialização por ser tratar de um produto novo com características sensoriais agradáveis do ponto de vista do consumidor.

  • MARIA EDUARDA GARCIA DE SOUSA PEREIRA
  • BIOECOLOGIA, ETNO-HABITATS E PESCA DO CAMURIM Centropomus undecimalis (Bloch, 1792) (CENTROPOMIDAE - PERCIFORMES) NA ZONA COSTEIRA AMAZÔNICA BRASILEIRA: IMPLICAÇÕES PARA O MANEJO PESQUEIRO

  • Data: 04/12/2020
  • Mostrar Resumo
  • O Centropomus undecimalis (Bloch, 1792), é um recurso pesqueiro amplamente explorado pela frota artesanal e industrial no litoral amazônico, contribuindo com a produção de alimentos, geração de renda e trabalho. Contudo, é um recurso pouco estudado e dependente dos ecossistemas costeiros, ambiente sob pressão pesqueira e antrópica. Diante desses pontos, a presente pesquisa teve como objetivo descrever a bioecologia e pesca do C. undecimalis capturado no litoral Amazônico brasileiro a partir do conhecimento dos atores da pesca, bem como, traçar o perfil socioecômico destes, visando o manejo, conservação e a sustentabilidade da pescaria. Os dados foram obtidos por meio de entrevistas semiestruturadas junto aos pescadores, mestres e donos de embarcações, entre março e maio de 2019 no município de Bragança (PA), por meio da técnica snowball e registros fotográficos. Os dados foram tabulados e analisados em planilhas eletrônicas dos Software Microsoft Office Excel, Past e IRAMUTEQ. Traçado o perfil socioeconômico dos entrevistados com base na idade, escolaridade, tempo de atuação na pesca e renda foi observado que não houve diferença significativa entre os participantes, indicando um grupo similar, exceto em relação à renda, que variou significativamente em função da ocupação/profissão, tendo os pescadores a renda significativamente inferior a do mestre e donos de embarcações. Com relação a bioecologia, a espécie é conhecida localmente como camurim, robalo e camurim-preto. Sendo encontradao ao longo do litoral amazônico brasileiro, distribuído em 20 etno-habitats. Destes, 49,1% encontram-se no ambiente costeiro/marinho, 47,1% no estuarino e 3,8% no dulcícola. Alimentam-se, preferencialmente de peixes, seguido de crustáceos e insetos. Essa espécie reproduz ao longo do ano, porém, com maior frequência entre os meses de junho e dezembro, período de transição chuvoso-seco e período seco. A migração ocorre em função da sazonalidade local, fase de vida e habitat. Á pesca desse recurso no litoral amazônico acontece, principalmente, por meio das embarcações artesanais que variam de pequeno a médio porte e utilizam, essencialmente, rede móvel do tipo pescadeira que normalmente é utilizada na captura da pescada-amarela. Atuam em pesqueiros próximos ou distantes dos locais de desembarque, conhecidos popularmente como “Norte” (AP), “Emburateuas”, “Poços”, Barra de Bragança (PA) e porção costeira do Maranhão (MA). A captura dessa espécie é realizada durante o ano todo, embora, sua produção seja baixa e irregular. Contudo, tem alto valor comercial e boa aceitação no mercado, especialmente, o nacional. Os resultados apresentados, a partir de uma perspectiva integrada de conhecimentos, empírico e científico, pode ser peça chave no ponto de partida para o manejo e conservação dessa espécie no litoral amazônico brasileiro. O que possibilitou sugerir para o estuário do rio Caeté áreas de berçário, alimentação, crescimento e reprodução para essa espécie. Adicionalmente, a baixa e irregularidade das capturas evidenciada nessa pesquisa acende um sinal de alerta sobre o estado do estoque dessa espécie e abre novas possibilidades de investigação com a hipótese da inadequação da técnica de pesca empregada atualmente na sua captura.

  • BLENDA PATRÍCIA DAMASCENO DE OLIVEIRA
  • CARACTERIZAÇÃO DO MERCADO DE CARNE BOVINA PREMIUM NO MUNICÍPIO DE BELÉM, ESTADO DO PARÁ, BRASIL

  • Data: 17/08/2020
  • Mostrar Resumo
  • O Brasil detém o maior rebanho comercial de bovinos do mundo, com cerca de 213,52 milhões de cabeças de gado, e o maior exportador mundial de carne, responsável por 14,4% da produção global. Em 2018, o PIB da pecuária de corte atingiu 8,7% na participação no PIB total brasileiro, encerrando o ano com crescimento no volume de carne bovina produzida, com 10,96 milhões de toneladas equivalente carcaça (TEC), 12,8% acima ao ano de 2017. Com a globalização, juntamente com o crescimento dos níveis de renda, o mercado nacional da carne bovina vem passando por mudanças com o surgimento de novas tendências e nichos de mercado, cada vez mais exigentes por carnes de alta qualidade, fazendo com que o sistema produtivo busque novas estratégias de produção, como investimento em genética, manejo dos animais, além de investimentos em tecnologias para melhoria da qualidade dos produtos entregues aos consumidores. Por isso, considerar o comportamento do consumidor é de extrema importância na economia global, pois ele é percebido como elemento estratégico na dinâmica do mercado, principalmente considerando as demandas sanitárias e de segurança alimentar e nutricional das cadeias agroalimentares modernas. Assim, nesse cenário de mudança na preferência do consumidor, produtos premium ganham destaque crescente no setor alimentício, o que pode ser medido pelo surgimento de boutiques de carne e pelo interesse dos grandes varejistas em produtos diferenciados, com apelo maior pelo consumidor. A carne premium pode ser conceituada como proveniente de método de criação ou raça, independente da parte do animal, o que torna o produto final diferente do comum, por ser proveniente de processo produtivo que acompanha qualidade, desde a sua origem na fazenda, atendendo aos padrões de raça e idade pré-estabelecidos, bem-estar animal, consciência socioambiental. A cada 40 milhões de cabeças abatidas ao ano, somente 800 mil são animais destinados ao mercado de carne premium, ou seja, representa apenas 2% do volume total. Desse modo, aventa-se que a demanda por carne de alta qualidade tem sido muito maior do que a quantidade ofertada de animais no padrão exigido, e apesar desse aumento da exigência dos consumidores, esse nicho de mercado ainda é recente e pouco explorado, merecendo, ainda, estudos sobre sua dinâmica e potencial. Diante desse contexto, a pesquisa visa caracterizar o mercado de carne bovina premium, no município de Belém, estado do Pará, para analisar o mercado desse produto, desde os varejistas aos consumidores finais, a fim de verificar as potencialidades do mercado e analisar a percepção e perfil de seus consumidores. No levantamento dos dados foi aplicado questionário semiestruturado, junto aos consumidores, com amostra de 95% de confiança e margem de erro de 5%. Além disso, foram realizadas entrevistas com distribuidores e varejistas de carne premium (donos de boutiques de carnes, casas de carnes e restaurantes). Os resultados da pesquisa evidenciam que os consumidores são conscientes sobre o produto que estão consumindo, o que demonstra conhecimento sobre a carne bovina premium e que procuram características que resultem em qualidade superior. Ressalta-se ainda que esses consumidores demandam por qualidade e não quantidade. Entre as características mais apreciadas e principais influentes na decisão de compra dos consumidores de carne bovina premium, no município de Belém, destaca-se aparência, qualidade, maciez, preço, quantidade, procedência e corte. As ações de divulgação das marcas de carne premium influenciam na decisão de compra de carne, bem como a utilização de selos de certificação nas embalagens. 

  • LIZIANE AMARAL BARBOSA GONÇALVES
  • BIOLOGIA REPRODUTIVA DE HYPOPHTHALMUS MARGINATUS E ESTUDO COMPARATIVO DA ESPERMIOGÊNESE HYPOPHTHALMUS MARGINATUS, AGENEIOSUS UCAYALENSIS E AUCHENIPTERICHTHYS LONGIMANUS (TELEOSTEI: SILURIFORMES)


  • Data: 17/08/2020
  • Mostrar Resumo
  • O presente estudo tem como objetivo analisar aspectos da biologia reprodutiva, proliferação das células germinativas no testículo de Hypophthalmus marginatus, bem como comparar a morfologia dos espermatozóides de Hypophthalmus marginatusAgeneiosus ucayalensis e Auchenipterichthys longimanus baseado em análises ultraestruturais. Para isso o trabalho foi desenvolvido em três capítulos. O primeiro verificou a proporção sexual entre fêmeas e machos de H. marginatus, estágios de maturação sexual; índice gonadossomático; período reprodutivo, tipo de desova; fator de condição e tamanho médio na primeira maturação sexual a jusante da barragem hidrelétrica de Tucuruí. A atividade reprodutiva ocorreu a jusante da barragem. Esta atividade reprodutiva coincidiu com o aumento da vazão, oxigênio dissolvido. O segundo descreveu a estrutura testicular e a ultraestrutura de células germinativas de Hypophthalmus marginatus durante a espermatogênese. H. marginatus apresentaram testículos filiformes, o parênquima testicular é composto por células da linhagem espermatogênica e células de Sertoli. As células espermatogênicas estão organizadas em cistos espermáticos. Durante a espermiogênese as espermatídes não apresentaram rotação nuclear, o centríolo proximal é perpendicular ao centríolo distal, característico da espermiogênese do tipo III. Morfologicamente os espermatozoides apresentaram cabeça ovóide sem acrossoma, um núcleo condensado e uma fossa nuclear rasa, peça central curta com um único longo flagelo, que exibe a estrutura do axonema típico de nove pares de microtúbulos periféricos e um central. A peça final é fina com apenas microtúbulos periféricos. O terceiro capítulo analisou a morfologia dos espermatozóides de Hypophthalmus marginatusAgeneiosus ucayalensis e Auchenipterichthys longimanus. Os resultados demostraram que algumas características evidenciadas nos espermatozoides de Hypophthalmus marginatusAgeneiosus ucayalensis e Auchenipterichthys longimanus permanecem conservadas, como a cabeça sem acrossoma, peça intermediária, uniflagelar e axonema clássico de 9+2 microtúbulos. Estas informações podem contribuir para a gestão do recurso pesqueiro e subsidiar o aproveitamento de H. marginatus na aquicultura. Bem como contribuir para os estudos filogenéticos entre os grupos de Siluriformes.

  • ALINE DA ROSA LOPES
  • Efeitos do sombreamento e da adubação nitrogenada nas características morfogenéticas, estruturais, produtivas e anatômicas foliares de dois cultivares de Megathirsus maximum

  • Data: 29/05/2020
  • Mostrar Resumo
  • Uma alternativa promissora dentro da pecuária brasileira é o estabelecimento de sistemas silvipastoris, que podem ajudar a reduzir problemas de desmatamento e degradação das pastagens já implantadas. Todavia, a escolha da gramínea, o nível de sombreamento por ela suportado, e a utilização da adubação nitrogenada, são fatores que interferem diretamente nesse tipo de sistema. Nesse intuito, objetivamos com este estudo avaliar as características morfogenéticas e estruturais, acúmulo de biomassa, e a anatomia foliar das cultivares de Megathirsus maximum Tamani e Quênia, quando cultivadas sob três níveis de sombreamento e quatro níveis de adubação nitrogenada. O estudo foi realizado durante o período chuvoso, outubro de 2018 a abril de 2019, em área pertencente à Universidade Federal de Goiás. O delineamento experimental utilizado foi em blocos casualizados com os tratamentos constituídos por um esquema fatorial (2x3x4) com três repetições, sendo duas gramíneas (Megathirsus maximum cv. Tamani e Megathirsus maximum cv. BRS Quênia) submetidas a três níveis de sombreamento artificial (0, 30 e 50%) e quatro doses de adubação nitrogenada equivalentes a 0, 100, 200 e 300 kg ha-1ano-1, o que totalizou 72 unidades experimentais. Foram avaliadas as caracteristicas morfogenéticas e estruturais das gramíneas, os acúmulos de forragem total e diário, a relação folha/colmo, bem como as variáveis anatômicas das lâminas foliares. Para a variável filocrono, o capim Quênia mostrou-se mais eficiente que o Tamani até a utilização de 100 kg de N ha-1, até onde os menores valores foram observados. As taxas de aparecimento de perfilhos (TAP) da cultivar Tamani foram superiores (p<0,05) que as da cultivar BRS Quênia quando aplicadas as doses de N, sendo que a BRS Quênia apresentou resposta quadrática, e a Tamani resposta linear crescente na TAP com o aumento das doses de N aplicadas. O acúmulo de forragem total (ACFT) da cultivar Tamani foi superior (9098 kg ha-1) a BRS Quênia (6939 kg ha-1) na ausência de sombreamento, todavia, nos sombreamentos de 30 e 50% o acúmulo foi igual entre as cultivares. A área total dos tecidos da lâmina foliar apresentou diminuição (p<0,05) no capim Quênia com o aumento da adubação nitrogenada, já o capim Tamani não diferiu estatisticamente de uma dose para outra (p>0,05), sendo que na dose de 300 kg de N ha-1, o capim Tamani apresentou maior (p<0,05) média que o Quênia.

     

  • JHONATAN WILLIANS PIMENTEL COSTA
  • Ciclo reprodutivo, desenvolvimento embrionário e morfologia funcional do estômago e apêndices bucais de larvas do camarão ornamental marinho Lysmata ankeri (Rhyne e Lin, 2006)

  • Data: 30/03/2020
  • Mostrar Resumo
  • O objetivo do trabalho foi descrever o ciclo reprodutivo e o desenvolvimento embrionário de L. ankeri em condições de laboratório, assim como descrever a morfologia do estômago de larvas zoea I, zoea II e último estágio larval, relacionando com a sua funcionalidade, além dos apêndices bucais de zoea I. Os camarões foram obtidos de uma empresa de aquariofilia marinha do estado da Bahia e mantidos no Laboratório de Aquicultura da Universidade Federal do Pará. No laboratório os camarões foram distribuídos em tanques acoplados a um sistema de recirculação de água. Para a realização dos experimentos sobre o ciclo reprodutivo e desenvolvimento embrionário, os camarões foram separados em casais em cada tanque. Um total de oito casais foram observados durante cinco ciclos consecutivos, no qual foi verificado o tempo de desenvolvimento embrionário, tempo entre desovas, tempo entre ninhadas e o tempo de desenvolvimento da porção ovariana da gônada, além da coloração do ovário e dos ovos. Para as análises dos estômagos e apêndices bucais, foram utilizados larvas no estágio zoea I, zoea II e último estágio larval. As amostras foram tratadas conforme Abrunhosa et al. (1997). Dos oito casais analisados no estudo, foi possível registrar 40 desovas em um total de 189 dias. O tempo de desenvolvimento embrionário variou de 11 a 13 dias (11,7 ± 0,18; média ± DP). O período de incubação dos ovos foi simultâneo ao período de desenvolvimento do ovário, ocorrendo a ecdise pré-acasalamento e a desova entre 12 e 24 horas após a eclosão das larvas. A coloração do ovário variou de tons de cinza claro a tons laranja avermelhado, desde a gônada esgotada até desenvolvida, respectivamente. O desenvolvimento embrionário foi caracterizado em 11 períodos, com as larvas eclodindo com pouca reserva vitelínica, mas que são capazes de mudar para o estágio seguinte sem a presença de alimento. A coloração dos ovos variou de tons laranja avermelhado à marrom acinzentado, a partir do momento da desova até perto da eclosão, respectivamente. Em relação às análises dos estômagos e apêndices bucais, foi possível observar que as larvas de L. ankeri apresentam estruturas em sua morfologia que são capazes de capturar e digerir alimentos a partir do primeiro estágio larval, e que sofrem modificações significativas ao longo do seu desenvolvimento, sendo capazes de ingerir alimentos pequenos e moles, como microalgas e náuplios de Artemia nos primeiros estágios larvais, até alimentos duros e maiores, como ração comercial, no último estágio larval. Conclui-se que L. ankeri possui um ciclo reprodutivo relativamente rápido e contínuo e que suas larvas apresentam estômagos e apêndices bucais funcionais, podendo ser alimentadas já nas primeiras horas após a eclosão.

  • JULIANA CRISTINA DE CASTRO BUDEL
  • Efeito da inclusão de tortas amazônicas no consumo, digestibilidade, variáveis sanguíneas, desempenho e emissão de metano em ovinos e estratégias de amostragem e extração de DNA para avaliação de perfis microbianos ruminais

  • Data: 06/03/2020
  • Mostrar Resumo
  • Dois estudos distintos foram conduzidos com abordagens nutricionais e genéticas como ferramentas para reduzir a emissão de CH4 em ovinos. No primeiro estudo, realizado em Castanhal, Pará, Brasil, avaliou-se o efeito da inclusão de tortas amazônicas no consumo, digestibilidade, variáveis sanguíneas, desempenho e emissão de metano em ovinos. Vinte e oito ovinos foram distribuídos em quatro tratamentos: 1. teor reduzido de óleo - dieta controle (TRO); 2. contendo torta de cupuaçu - Theobroma grandiflorum (CUP); 3. contendo torta de tucumã - Astrocaryum aculeatum (TUC); e 4. teor elevado de óleo - dieta controle (TEO). A dieta contendo torta de tucumã afetou negativamente o consumo e digestibilidade dos ovinos. As tortas de cupuaçu e tucumã causaram aumento nos níveis de colesterol total, triglicerídeos e HDL (P<0,05), contudo, não afetaram as concentrações de glicose, proteína e albumina (P >0,05) dos animais experimentais. Aqueles que receberam dietas CUP, TUC e/ou TEO apresentaram as menores emissões de CH4 em g/d e L/d (P<0,05), no entanto, não houve efeito das dietas quando considerada a variável CH4, g/kg CMS. No segundo estudo, realizado em Mosgiel, Nova Zelândia, investigou-se o uso de soluções (Solução A, Solução B e Solução C) como métodos alternativos ao utilizado rotineiramente (controle) na investigação do perfil microbiano ruminal de ovinos. Avaliou-se a adequação das soluções às etapas de amostragem, armazenamento, processamento, extração de DNA e sequenciamento de representação reduzida, pela técnica GBS (genotyping by sequencing). No total, 151 ovelhas (n = 85 baixa emissão; e n = 66 alta emissão de metano) foram usadas para coleta de metano entérico e amostragem do conteúdo ruminal. Ambas coletas foram repetidas após duas semanas (n = 302) para determinação da repetibilidade dos métodos testados. A concentração, pureza e intregridade do DNA variou dependendo do método utilizado (p<0.0001). A integridade do DNA extraído de amostras ruminais preservadas com a solução C foi afetada, o que comprometeu sua aplicação na técnica de sequenciamento, usando-se enzimas de restrição. O número de leitura por amostra, da mesma forma, foi influenciado pelo método usado (p<.0001). A menor média foi observada na solução C (510K reads), em contraste com a maior, observada na solução A (1M reads). As soluções A e B possuem potencial para serem utilizadas como métodos alternativos na avaliação do perfil microbiano de ovinos.

  • ANTONIA RAFAELA GONÇALVES MACEDO
  • SISTEMAS DE CULTIVO, DENSIDADE E PARASITOLOGIA EM OSTRAS (Crassotrea gasar) CULTIVADAS NA AMAZÔNIA ORIENTAL”

  • Data: 04/03/2020
  • Mostrar Resumo
  • A ostreicultura é uma atividade em franco crescimento tanto em nível nacional, como no estado do Pará. Essa atividade é desenvolvida em dois diferentes sistemas de cultivo: flutuante (balsas ou long line) e fixo (mesas), porém ainda não se sabe qual sistema é mais eficiente quanto ao desempenho produtivo das ostras. Neste sentido, a hipótese é de que o sistema de cultivo interfere diretamente na sobrevivência, crescimento e a ação de predadores. Diante do exposto, o objetivo da pesquisa é avaliar qual o sistema de cultivo é mais eficiente, considerando o desempenho zootécnico e econômico. Para isto será montado um experimento na comunidade de Nova Olinda, município de Augusto Correa, a qual apresenta os dois sistemas de cultivo supracitados. O desempenho zootécnico das ostras será avaliado por meio de um experimento com delineamento inteiramente casualizado com dois tratamentos e sete repetições totalizando 14 unidades experimentais. Ao longo da fase experimental o manejo do cultivo de ostras nos dois sistemas será realizado em três fases: 1) fase de berçário (sementes); 2) fase intermediária (juvenis); e 3) fase de engorda (adultas).  O manejo e a limpeza das ostras acontecerão, mensalmente, para a retirada, contagem e classificação de predadores e incrustantes. Além do mais, serão realizadas mensalmente as medidas biométricas de altura (A), comprimento (C) e largura (L), com o auxílio de um paquímetro de precisão de 0,05 mm para o acompanhamento do crescimento das ostras, na proporção de 10% do número total de animais vivos e o peso (p). Serão realizadas também, análises de parâmetros de qualidade de água nos dois sistemas.  Sendo realizados, mensalmente, os teores de oxigênio dissolvido (mg/L) pelo oxímetro digital, salinidade por meio de um refratômetro, e as medidas de temperatura (°C) ([média ± desvio]) e pH ([média ± desvio]) serão aferidas com um peagâmetro digital. O desempenho econômico de cada sistema será avaliado por meio de uma análise de custos. Os dados serão analisados por uma (ANOVA). Quando “F” for significativo, as médias de cada tratamento serão comparadas pelo teste de Tukey (p<0,05). Com isto, espera-se saber qual o melhor sistema de cultivo, no que refere ao desempenho econômico e zootécnico.

    A ostreicultura é uma atividade em franco crescimento tanto em nível nacional, como no estado do Pará. Essa atividade é desenvolvida em dois diferentes sistemas de cultivo: flutuante (balsas ou long line) e fixo (mesas), porém ainda não se sabe qual sistema é mais eficiente quanto ao desempenho produtivo das ostras. Neste sentido, a hipótese é de que o sistema de cultivo interfere diretamente na sobrevivência, crescimento e a ação de predadores. Diante do exposto, o objetivo da pesquisa é avaliar qual o sistema de cultivo é mais eficiente, considerando o desempenho zootécnico e econômico. Para isto será montado um experimento na comunidade de Nova Olinda, município de Augusto Correa, a qual apresenta os dois sistemas de cultivo supracitados. O desempenho zootécnico das ostras será avaliado por meio de um experimento com delineamento inteiramente casualizado com dois tratamentos e sete repetições totalizando 14 unidades experimentais. Ao longo da fase experimental o manejo do cultivo de ostras nos dois sistemas será realizado em três fases: 1) fase de berçário (sementes); 2) fase intermediária (juvenis); e 3) fase de engorda (adultas).  O manejo e a limpeza das ostras acontecerão, mensalmente, para a retirada, contagem e classificação de predadores e incrustantes. Além do mais, serão realizadas mensalmente as medidas biométricas de altura (A), comprimento (C) e largura (L), com o auxílio de um paquímetro de precisão de 0,05 mm para o acompanhamento do crescimento das ostras, na proporção de 10% do número total de animais vivos e o peso (p). Serão realizadas também, análises de parâmetros de qualidade de água nos dois sistemas.  Sendo realizados, mensalmente, os teores de oxigênio dissolvido (mg/L) pelo oxímetro digital, salinidade por meio de um refratômetro, e as medidas de temperatura (°C) ([média ± desvio]) e pH ([média ± desvio]) serão aferidas com um peagâmetro digital. O desempenho econômico de cada sistema será avaliado por meio de uma análise de custos. Os dados serão analisados por uma (ANOVA). Quando “F” for significativo, as médias de cada tratamento serão comparadas pelo teste de Tukey (p<0,05). Com isto, espera-se saber qual o melhor sistema de cultivo, no que refere ao desempenho econômico e zootécnico.

  • WALÉRIA CRISTINA LOPES JOSET
  • Efeito de dietas contendo coprodutos da agroindústria da amazónia oriental brasileira sobre o perfil de ácidos graxos da carne e gordura de cordeiros

  • Data: 04/03/2020
  • Mostrar Resumo
  • Estudou-se o efeito de dietas contendo torta de cupuaçu, dendê ou tucumã sobre o perfil de ácidos graxos do músculo Longissimus lumborum e do tecido adiposo de cordeiros mestiços Dorper-Santa Inês, em Castanhal, Pará, Brasil. Foram utilizados vinte e quatro cordeiros (30,05±2,45 kg) castrados, distribuídos em delineamento inteiramente casualizado, em quatro tratamentos: dieta controle (MFS), sem adição de tortas, e dietas com adição de 45% de torta de cupuaçu (TC), 30,9% de torta e dendê (TD) ou 17,6% de torta de tucumã (TT). Todas as dietas eram isonitrogenadas e com 6 % de extrato etéreo e a relação volumoso:concentrado foi de 40:60. Observou-se que os ácidos graxos em maior quantidade na carne e gordura dos cordeiros foram o palmítico, esteárico e oléico, com médias de 22,73%, 18,04% e 43,45%, respectivamente, no músculo e 22,35%, 36,08% e 26,88%, na gordura. A inclusão da TC ou TT aumentou a concentração do ácido esteárico na carne e no tecido adiposo, e a dieta com TC elevou a concentração deste ácido. Os cordeiros alimentados com as dietas contendo TD ou TT apresentaram maior concentração total de ácidos láurico e mirístico, no músculo e na gordura. A adição da TD aumentou a quantidade de ácidos graxos saturados presentes no tecido adiposo, em relação às demais dietas. Houve maior concentração de ácidos graxos poli-insaturados na gordura no tratamento com TC. No tecido adiposo, o ácido linoléico teve sua quantidade elevada com a adição da TC e, nesse mesmo tecido, a TC e TT aumentaram a concentração do ácido graxo ômega 3, e o ácido graxo ômega 6 teve sua concentração elevada com adição da TC. Houve redução na quantidade de CLA-c9t11 da gordura dos cordeiros alimentados com as dietas contendo TD ou TT. Conclui-se que a adição das tortas de cupuaçu e tucumã melhora a composição dos ácidos graxos nos tecidos de cordeiros, quando comparadas à torta de dendê, e que especialmente a torta de cupuaçu aumenta o teor de ácidos graxos poli-insaturados totais, ômega 3 e ômega 6 e reduz a concentrações de ácidos saturados no tecido adiposo dos cordeiros, tornado o produto mais saudável para consumo humano.

  • EDUARDO BAIA DE SOUZA
  • Utilização de plasma rico em plaquetas na produção in vitro de embriões bovinos.

  • Data: 28/02/2020
  • Mostrar Resumo
  • Um dos aspectos relevantes a se considerar para o sucesso durante a produção in vitro (PIV) de embriões é a constituição dos meios que compõem as etapas da biotecnologia reprodutiva. Os meios precisam suprir as necessidades metabólicas tanto dos gametas, durante a maturação oocitária e capacitação espermática, quanto do embrião durante as primeiras divisões celulares. A maior parte dos protocolos de PIV utiliza algum soro sanguíneo na composição dos meios como fonte de hormônios, proteínas, fatores de crescimento e nutrientes. Por outro lado, o soro contém citocinas, vitaminas e muitas outras substâncias que podem afetar a maturação, a fertilização e o desenvolvimento embrionário. Diversos trabalhos vêm reportando a utilização de Plasma Rico em Plaquetas (PRP) como alternativa para utilização de soros fetais durante o cultivo de células, principalmente de células tronco. Outros estudos demonstraram que o PRP está repleto de fatores de crescimento, como FGF, TGFβ, PDGF, IGF e EGF, bem como fatores de ligação como fibrinogênio e serotonina, vitais para a cultura celular e foliculogênese. Portanto, este trabalho tem por objetivo avaliar a utilização de PRP em substituição ao soro fetal bovino (SFB) durante a maturação de oócitos utilizados na produção in vitro de embriões bovinos. Os complexos cúmulos-oócitos (CCOs) foram distribuídos nos seguintes grupos experimentais durante a maturação in vitro (MIV): Grupo G1 (Meio de MIV com adição de 5% de PRP); Grupo G2 (Meio de MIV com adição de 5% de PRP mais 5% de SFB); Grupo G3 (Meio de MIV com adição de 5% de SFB); e grupo G4 (Meio de MIV sem adição de PRP e/ou SFB); . Após 20 horas de maturação, os CCOs foram passados para a placa de fecundação contendo o meio TALP FERT livre de soros. Aproximadamente 24 horas após a fertilização, os prováveis zigotos foram transferidos para gotas com meio SOF (“Synthetic fluid oviduct”) contendo 10% de SFB. foram avaliadas as taxas de clivagem e formação de blastocistos nos dias 2 e 7, do desenvolvimento embrionário, respectivamente. Também foi avaliada a qualidade dos CCOs maturados a partir da análise de expressão gênica de alguns marcadores genéticos. Os resultados demonstraram que não houveram diferenças significativas em relação aos grupos experimentais no tocante a taxas de produção de embriões (tanto nas primeiras clivagens quanto na formação de blastocistos) evidenciando que o PRP pode se tornar uma alternativa mais barata na PIVE em comparação ao SFB.
    Palavras-chave: Embrião; Soro fetal bovino; Maturação in vitro; Plasma Rico em Plaqueta

  • ANTONIO MARCOS QUADROS CUNHA
  • Tanino em suplementos na recria de bovinos nelore no período de transição águas-secas

  • Data: 28/02/2020
  • Mostrar Resumo
  • Objetivou-se avaliar os efeitos do tanino em suplementos protéico- enrgéticos com diferentes quantidades de uréia sem comprometer o desempenho através da modificação do metabolismo ruminal de animais nelore na recria no período de transição águas-secas. O delineamento experimental foi em esquema fatorial 2 × 2. Os fatores incluíram: 1) baixa e alta quantidade de uréia e 2) presença ou ausência de tanino (SilvaFeed Bypro®). O suplemento protéico- energético (22% de proteína bruta) foi fornecido, diariamente, na quantidade de 2 g/kg de peso corporal. O estudo foi dividido em dois experimentos (1 – avaliação de parâmetros ruminais, sanguíneos, consumo, balanço de nitrogênio e população de protozoários e 2 – avaliação do desempenho animal). O experimento de metabolismo teve início no dia 25 de fevereiro e término no dia 20 de maio de 2018, com duração de 84 dias, divididos em quatro períodos de 21 dias de avaliação. O experimento de desempenho teve início no dia 5 de fevereiro e término no dia 14 de maio de 2018, com duração de 97 dias, divididos em um período de adaptação de 14 dias e três períodos de avaliação sendo dois de 28 dias e um de 27 dias. No exp. 1, foram utilizados oito bovinos Nelore, distribuídos em um duplo quadrado latino. No exp. 2, foram utilizados 64 bovinos Nelore, distribuídos em 16 piquetes (4 piquetes por tratamento e 4 animais por piquete) em blocos completos ao acaso. As análises estatísticas foram realizadas utilizando o PROC MIXED do SAS. O nível de significância foi declarado a 5% de probabilidade e tendência explorada de 5 a 10%. O peso corporal final e o ganho médio diário teve tendência de ser maior (P = 0,08) para baixa uréia. Não houve interação e nem diferença (P > 0,05) para o consumo de matéria seca total, do suplemento, da forragem e digestibilidade. Não houve interação e nem diferença (P > 0,05) para as variáveis consumo de nitrogênio, nutrientes digestíveis totais, produção de proteína bruta microbiana e eficiência do uso de nitrogênio. Dentre os parâmetros ruminais, o acetato teve tendência a interação para o fator uréia e tanino. O acetato, propionato, butirato, valerato, isovalerato e a relação acetato:propionato aumentaram (P < 0,05) a partir das 6 horas após a alimentação. O pH diminuiu após a suplementação e teve aumento após as 12 horas pós alimentação. Não houve interação para o nitrogênio amoniacal (P > 0,05), o mesmo aumentou na hora três após a alimentação (P < 0,05) com redução nas horas seguintes. Os parâmetros sanguíneos, apenas a glicose teve interação para os fatores uréia, tanino e coleta (P = 0,04), as proteínas totais tiveram tendência para o fator uréia, com valores maiores para baixa uréia. Todos os parâmetros sanguíneos foram diferentes para o fator coleta (P < 0,01). Não houve interação entre os fatores para a variável população de protozoários (P > 0,05), os protozoários do gênero Charonita apresentaram maior número na baixa uréia (P = 0,03), enquanto que os do gênero Metadinium foram mais numerosos na presença de tanino. No período de transição águas- seca com pastos apresentando estrutura prejudicial ao pastejo e com qualidade baixa representado pelo elevado teor de fibra e baixa proteína, as diferentes quantidades de uréia e a presença do tanino não modificaram o desempenho de animais Nelore na recria, apesar de haver influência em alguns parâmetros ruminais.

  • MATHEUS HENRIQUE CORREA MARQUES
  • O mercado do camarão-da-Amazônia Macrobrachium amazonicum no estado do Pará: possibilidades de inserção da espécie na produção aquícola

  • Data: 27/02/2020
  • Mostrar Resumo
  • O camarão-da-Amazônia Macrobrachium amazonicum é um recurso pesqueiro explorado com fins de subsistência e comerciais em todo o estado do Pará, sendo consumido por membros de todas as classes sociais. O objetivo deste estudo foi analisar o perfil do consumidor do camarão-da-Amazônia no estado do Pará. Entre fevereiro e agosto de 2019 foi realizada a aplicação de um total de 1.260 questionários à consumidores de pescado dos municípios de Belém (390), Cametá (296), Tucuruí (288), Altamira (83), Santarém (120) e Breves (83). As informações obtidas foram tabuladas em planilhas eletrônicas e apresentadas por meio de estatística descritiva. Constatou-se que 92,3% do público abordado consumia o crustáceo e que 81,9% deste total possuía renda familiar mensal de até dois salários mínimos. Em termos de frequência, 78,2% declarou consumir o produto pelo menos uma vez por semana. A preferência de 71,7% dos entrevistados era pelo camarão inteiro e 54,2% priorizavam a aquisição do produto vivo ou fresco. Apesar do poder aquisitivo relativamente baixo dos consumidores, o camarão-da Amazônia apresenta um mercado atraente no estado do Pará, inclusive para o produto sem beneficiamento.

  • JOELMA KYONE SILVA DE OLIVEIRA
  • Uso de extrato de tanino na substituição de monensina em dieta de bovinos nelore terminados a pasto

  • Data: 27/02/2020
  • Mostrar Resumo
  • Dois ensaios (metabolismo e desempenho) foram realizados com o intuito de utilizar um blend com extratos de tanino e saponinas na substituição de monensina em animais nelore terminados intensivamente a pasto. No primeiro ensaio, o objetivo foi avaliar o efeito dessa substituição na fermentação ruminal. Os tratamentos utilizados foram: CN - controle sem aditivo, 25T - inclusão de 0,25% do blend na matéria seca, 50T - inclusão de 0,50% do blend na matéria seca e MN - inclusão de 30 ppm de monensina na matéria seca. Foram utilizados 8 animais canulados no rúmen alocados em 8 piquetes junto a outros animais testes sob o mesmo sistema alimentar, arraçoados rigorosamente as 8h da manhã. O delineamento experimental se deu em um duplo quadrado latino. O pH e a quantificação de ácidos graxos de cadeia curta (AGCC) foram mensurados nas horas 0, 6, 12 e 18 após o fornecimento da alimentação. O nitrogênio amoniacal (N-NH3) foi quantificado nas horas 0, 3, 6, 9, 12, 15, 18 e 21 pós alimentação. Os metabólitos sanguíneos foram verificados nas horas 0, 2, 4 e 6 após alimentação. Foram utilizados indicadores externos de consumo para determinar as quantidades ingeridas de pasto e ração, bem como coletas fecais entra o 15º e 18º dia do período e coleta de urina no 16º dia do período para determinar absorção e excreção de nutrientes. No 19º, após quatro horas do fornecimento do trato foram coletadas amostras ruminais para a determinação da população de protozoários. Foram encontradas diferenças (P < 0,05) para pH, AGCC e N-NH3 e parâmetros sanguíneos apenas nas horas de coleta. Houve tendência (P < 0,10) para o consumo no %PC e diferença (P < 0,05) para o consumo de forragem, mas não para o consumo de suplemento (P > 0,05). Apena uma espécie, Isotricha, apresentou diferença para o tratamento aplicado. Como aditivo alternativo, e em virtude da semelhança entre os tratamentos é possível o uso de tanino na substituição da monensina em dietas onde os animais são terminados intensivamente a pasto. No segundo ensaio, a proposta foi a inclusão desse mesmo blend no desempenho e características de carcaça e carne dos bovinos. Para isso, foram utilizados 64 bovinos nelore, machos não castrados, com peso inicial de 381±13 e com idade em torno de 22 meses. Um delineamento em blocos ao acaso foi utilizado para distribuir os animais em 16 piquetes de Urocloa brizantha cv. Marandú (4 piquetes por tratamento e 4 animais por piquete) e o peso utilizado como fator de blocagem. Os tratamentos foram os mesmos do primeiro ensaio. Os animais foram pesados ao início do experimento, após 28 dias de adaptação e ao final do confinamento (100 dias). Ao final do experimento, todos os animais foram abatidos, no abate foram obtidos os pesos de carcaça quente e o grau de acabamento de todos os animais. Foram coletadas amostras de 32 animais para estimativa de composição corporal e qualidade da carne, uma amostra entre a 9ª e 11ª costelas e uma amostra na altura da 12ª costela para determinação da área de olho de lombo, espessura de gordura subcutânea e outras amostras para composição química, força, capacidade de retenção e coloração. As variáveis de peso corporal final e ganho médio diário não apresentaram diferença (P > 0,05), bem como as características de carcaça. Conversão alimentar (P < 0,10) e eficiência alimentar (P < 0,10) apresentaram tendência para o uso de monensina. Eficiência biológica apresentou resultado significativo para o uso do antibiótico (P < 0,05). Para as características de carne somente colágeno apresentou diferença significativa (P < 0,05) para o uso de tanino quando comparado ao controle. A albumina apresentou efeito para o tratamento aplicado (P < 0,05). Os dados sugerem que o uso de tanino pode substituir a monensina como um aditivo alternativo.

  • LUIZ HENRIQUE VILELA ARAUJO
  • BLOQUEIOS LOCORREGIONAIS EM BUBALINOS MACHOS E FÊMEAS: PARA EXPOSIÇÃO PENIANA, PARA LATERAL E ÚBERE.

  • Data: 21/02/2020
  • Mostrar Resumo
  • O trabalho foi dividido em duas etapas. A primeira com o objetivo de descrever a técnica de anestesia do nervo pudendo em búfalos jovens e adultos e avaliar seus efeitos motores e sensitivos no pênis, prepúcio, mucosa prepucial, testículos e escroto, além da ocorrência de exposição espontânea ou não do pênis. A segunda foi comparar os efeitos do bloqueio paravertebral isolado e associado ao bloqueio do nervo torácico lateral nas regiões da de flanco e glândula mamária. Nas duas etapas, utilizando lidocaína a 2%. Na primeira etapa do experimento, foram utilizados 13 búfalos machos da raça Murrah: adultos (GA, n=7) e jovens (GJ, n=6). Observou-se a ocorrência ou não de bloqueio motor (BM), por meio da inspeção direta do relaxamento da musculatura; para o bloqueio sensitivo (BS) foi utilizada agulha hipodérmica no intuito de buscar respostas à dor. O período de bloqueio motor e sensitivo foi determinado a partir da apresentação de relaxamento e não reação aos estímulos dolorosos, avaliados a cada 20 minutos até retorno do vigor e dor. A exposição do pênis ocorreu em 83% e 85.7%, iniciaram 20.2±17 e 19.6±10.1, durando 91.6±84.2 e 110±179.6, no GJ e GA, respectivamente. O BS do pênis não ocorreu em nenhum grupo. O BM do escroto ocorreu em 100% em ambos os grupos, iniciou 10.8±4.9 e 9.8±5.6, durando 138.3±51.9 e 139.2±83.5, no GJ e GA, respectivamente. O BS do escroto ocorreu de forma U ou B em 83.2% e 100%, iniciou 11.5±7.7 e 17.5±7.2, durando 103.8±80.9 e 108.3±94.9, no GJ e GA, respectivamente. Na segunda etapa foram utilizadas no experimento 12 búfalas, mestiças das raças Mediterrâneo e Murrah.  Foi feita a contenção, em seguida a avaliação da sensibilidade cutânea e a assepsia. O bloqueio paravertebral da lombar (BPV), foi feito entre as vertebras T13-L1, L1-L2, L2-L3, L3-L4 e L4-L5.  O bloqueio do nervo torácico lateral (BTL) foi feito com uma única infiltração na lateral da região torácica, passando uma linha imaginária na horizontal, seria a 4 cm de altura acima da tuberosidade do olecrano e 10 cm após o membro anterior (MA). Após os bloqueios anestésicos, a avaliação cutânea foi feita, utilizando uma pinça dente de rato, nos momentos (min.): 0, 5, 10 sendo repetidos de 10 em 10 minutos, até o 60. Ambos os bloqueios foram eficientes em anestesiar as regiões do flanco e ventral. A anestesia ocorreu em 83% e 91.3% na fossa paralombar (BPV), de 91.3% e 91.3% na lateral (L) e 83% e 91.3% na região ventral (RV), nos BPV) e paravertebral associado ao torácico lateral (BPV+BTL) respectivamente. Porém, ambos os bloqueios não foram eficientes em anestesiar os tetos anteriores (TA), a parte caudal do úbere (UCl) e os tetos posteriores (TP), anestesiando apenas 16.6% dos animais.  Foi na porção cranial do úbere (UCr) que ocorreu a maior diferenças entres os bloqueios, sendo 24.9% no BPV e 58.1% no (BPV+TL). Desta forma, verificou-se a eficiência das técnicas nas duas etapas experimentais.

  • OSNAN LENNON LAMEIRA SILVA
  • Efeitos ambientais na composição e na qualidade de ostras (Crassostrea gasar) cultivadas em estuários amazônicos

  • Data: 20/02/2020
  • Mostrar Resumo
  • A ostreicultura, está entre as atividades relacionadas a aquicultura, que mais contribui para a economia no mundo. No estado do Pará, a mesma tem apresentado grande potencial comercial, gerando renda a diversas comunidades. A ostra é considerada como excelente fonte nutricional. No entanto, seu consumo pode representar riscos à saúde dos consumidores, pois a mesma é comercializa, na maioria das vezes in natura, criando condições para o crescimento microbiano. Além disso, o histórico de atividades garimpeiras, próximos aos rios amazônicos e seu elevado entrelaçamento, possibilita as chances de contaminação por mercúrio. Diante disso, o presente trabalho objetivou avaliar os efeitos dos fatores ambientais, sobre a composição e qualidade das ostras Crassostrea gasar, cultivadas em estuários amazônicos. Essa pesquisa foi realizada em duas comunidades produtoras de ostras, (Área 1) Nova Olinda, no município de Augusto Corrêa e (Área 2) Lauro Sodré em Curuçá, ambas nos estado do Pará. Foram realizadas, seis vistas em cada comunidade, entre os períodos de maio de 2017 a fevereiro de 2018. Foram mensurados in loco as condições físico-químicas da água (salinidade, temperatura e pH) e captado os dados de precipitação local no site do Instituto Nacional de Meteorologia. Foram utilizadas 1572 ostras, para as análises de perfil de ácidos graxos, composição centesimal (umidade, cinzas, lipídios, proteínas e carboidratos), valor energético, atividade de água, pH, qualidade microbiológica (coliformes totais, termotolerantes, Echerichia coliStaphylococcus coagulase positiva, bolores, leveduras e Salmonella) e contaminação química por mercúrio. Os resultados mostram, diferenças significativas em relação aos fatores ambientais entre as áreas estudadas e períodos sazonais, sendo a Área 2, a de maior precipitação e menor salinidade. Nas ostras da área 2 e do período chuvoso foram encontrados os maiores valores de ácidos graxos polinsaturados. Nas ostras da Área 1, os maiores valores de cinzas, proteínas, lipídios e energia. Já quanto, aos maiores de atividade de água e pH nas carne das ostras, os mesmos foram encontrados nos períodos de maior precipitação e menor salinidade. Em relação a qualidade microbiológica, também foram encontradas diferenças significativas, na água e na carne das ostras entre as áreas e períodos sazonais. No entanto, dentro dos padrões microbiológicos, com exceção da presença de Salmonella, a qual não apresentou diferenças significativas entre os locais e períodos sazonais, e apresentou confirmação por PCR em 38,33% das amostras de ostras. Quanto aos níveis de mercúrio, foi confirmada diferença significativa entre os períodos sazonais, abaixo do limite máximo estabelecido para moluscos bivalves. O presente estudo, mostrou que as mudanças ocorridas nos fatores ambientais, durante os períodos sazonais amazônicos, configuram diferenças em vários constituintes e na qualidade dos cultivos de ostras, destacando a precipitação e a salinidade como os principais responsáveis por essas alterações. As ostras C. gasar se mostram excelentes fornecedoras de nutrientes, dentre eles os ácidos graxos polinsaturados EPA e DHA. A qualidade sanitária dos moluscos, foi comprometida pela presença de Salmonella e foram encontrados baixos níveis de mercúrio.

  • RODRIGO DOS SANTOS ALBUQUERQUE
  • Dopplerfluxometria da artéria testicular de búfalos jovens e adultos

  • Data: 20/02/2020
  • Mostrar Resumo
  • A utilização do Doppler associado à ultrassonografia bidimensional revela informações imediatas a respeito da arquitetura vascular e aspectos hemodinâmicos da artéria testicular, revelando ser uma técnica que detecta alterações no fluxo sanguíneo oriundos de desordens vasculares e teciduais, sendo útil e com alto potencial para avaliação no exame andrológico. O objetivo deste estudo foi descrever a avaliação ultrassonográfica em modo Doppler, determinando a ecogenicidade de animais jovens e adultos, bem como os valores dopplervelocimétricos da artéria testicular relacionando com a qualidade seminal de búfalos mantidos em central de reprodução. Foram utilizados 18 búfalos de raças Murrah e Mediterrâneo, sendo 13 animais púberes e 5 búfalos adultos mantidos em central de reprodução. Os animais foram submetidos a medidas de biometria testicular e logo em seguida as avaliações por ultrassonografia modo B para análise de ecogenicidade do parênquima testicular e Doppler colorido para registrar os parâmetros velocimétricos da artéria testicular. Foram encontradas lesões no parênquima testicular de três animais adultos e os outros dois mostraram normalidade no exame ultrassonográfico. Os animais adultos foram submetidos a colheita de sêmen por vagina artificial uma vez por semana durante cinco semanas totalizando 25 ejaculados, sendo realizada análises macro e microscópicas pré-congelação. Após a congelação, foram realizadas análises de cinética espermática por meio do CASA e análises de viabilidade e funcionalidade espermática por citometria de fluxo. Os animais púberes apresentaram padrão homogêneo de ecogenicidade com regiões lineares hiperecoicas levemente tortuosas ao longo do parênquima testicular. A avaliação ultrassonográfica em modo Doppler foi possível ser realizada somente na artéria supratesticular localizada no cordão espermático tanto em animais púberes quanto em adultos. Os parâmetros analisados pelo CASA e citometria de fluxo não revelaram diferenças significativas na qualidade do sêmen de animais com e sem alterações testiculares. Portanto, os búfalos mantidos em central de reprodução mesmo apresentando alterações testiculares produziram sêmen dentro dos padrões estabelecidos para congelação, mostrando que essas mudanças de ecogenicidades e lesões no escroto não influenciaram na produção e qualidade seminal.

  • MARIO MARTINS GUIMARAES
  • PARÂMETROS BIOMÉTRICOS E REPRODUTIVOS COMO INDICADORES DE FERTILIDADE EM NOVILHAS BÚFALAS PRÉ-PÚBERES SUBMETIDAS À IATF

  • Data: 19/02/2020
  • Mostrar Resumo
  • Os objetivos desse estudo foram (1) mensurar algumas características biométricas e reprodutivas de novilhas búfalas pré-púberes submetidas a programas de inseminação artificial em tempo fixo (IATF), assim como (2) determinar quais das variáveis observadas podem ser relacionadas com a prenhez por inseminação (P/IA). Foram utilizadas 75 novilhas pré-púberes de duas fazendas (Fazenda A - 43 animais; Fazenda B - 32 animais) com 23,33 ± 0,52 meses de idade, peso médio de 314,99 ± 4,54 Kg e escore de condição corporal (ECC; 1-5) 3,22 ± 0,04. Todas as fêmeas foram submetidas ao mesmo protocolo de inseminação artificial em tempo fixo (IATF). Dez dias antes do início do protocolo de sincronização (Dia -10) as novilhas foram avaliadas quanto à idade (meses), peso (Kg), ECC, altura de cernelha (hCERN, cm), altura da costela (hCOST, cm), profundidade de costela (pCOST, %) e escore do trato reprodutivo (ETR, escala de 1 a 5). As fêmeas que não apresentaram corpo lúteo (CL) nas avaliações ultrassonográficas dos dias -10 e 0 foram submetidas ao protocolo de sincronização da ovulação (D 0). A IATF foi realizada 11 dias após o início do protocolo. As variáveis resposta foram apresentadas como média ± EPM e porcentagem. A comparação entre as variáveis foi realizada por meio de análise de variância (ANOVA), usando o procedimento GLIMMIX do SAS® versão 9.3. Diferença significativa foi considerada quando P ≤ 0,05 e tendência quando P ≤ 0,10. As médias das medidas biométricas e reprodutivas foram: hCERN - 120,03 ± 0,50 cm; hCOST - 58,84 ± 0,81 cm; pCOST – 49 ± 0,21 %; ETR - 3,72 ± 0,09; diâmetro do maior folículo no D9 - 6,38 ± 0,16 mm; diâmetro do maior folículo na IATF - 8,34 ± 0,22 mm; taxa de ovulação de 68,0% (51/75); e taxa de prenhez aos 30 dias de 22,7% (17/75). Quando comparadas as fazendas (Fazenda A e Fazenda B) observamos algumas diferenças como idade (25,70 ± 1,25 vs. 22,59 ± 0,51 meses; P = 0,03), peso (327,28 ± 5,13 vs. 298,47 ± 7,22 Kg; P < 0,01), ECC (3,28 ± 0,05 vs. 3,14 ± 0,06; P = 0,08), hCERN (120,98 ± 0,65 vs. 118,75 ± 0,74 cm; P = 0,04), altura da costela (58,30 ± 0,39 vs. 59,56 ± 0,49 cm; P = 0,02), pCOST (48,2 ± 0,22 vs. 50,2 ± 0,30 %; P < 0,01), diâmetro do corpo do útero (18,74 ± 0,29 vs. 17,05 ± 0,40 mm; P < 0,01) e taxa de crescimento do maior folículo (0,03 ± 0,00 vs. 0,04 ± 0,01 mm/h; P = 0,08). Na comparação entre novilhas vazias e prenhes, observamos que a taxa de crescimento do maior folículo tendeu a ser menor nos animais que não emprenhariam (0,03 ± 0,01 vs. 0,05 ± 0,01 mm/h; P = 0,07) e a taxa de ovulação também foi menor nas novilhas vazias (58,6% vs. 100,0%; P < 0,01). Através desse estudo foi possível estabelecer algumas medidas biométricas e reprodutivas de novilhas búfalas pré-púberes com 16-36 meses de idade criadas a pasto, submetidas a programas de IATF. Além disso, concluiu-se que novilhas pré-púberes que emprenham à IATF diferem das fêmeas vazias somente pela taxa de ovulação, uma medida que é diretamente influenciada pelo desenvolvimento folicular durante a sincronização.

2019
Descrição
  • KARLYENE SOUSA DA ROCHA
  • Efeitos da adição de diferentes óleos vegetais nas características de carcaça e aspectos nutricionais da carne de cordeiros terminados em confinamento

  • Data: 13/12/2019
  • Mostrar Resumo
  • O objetivo do trabalho foi avaliar as características de carcaça, componentes não carcaça e aspectos nutricionais da carne de cordeiros terminados em confinamento com adição de óleo de babaçu ou buriti. Vinte e um cordeiros, peso médio inicial de 18±3 kg, castrados, ½ Santa Inês x ½ Dorper, foram distribuídos em delineamento blocos completos desbalanceados. Os tratamentos consistiram em três dietas isonitrogenadas, com relação volumoso:concentrado 30:70, dieta controle (CON), sem adição de óleo, e dietas com adição de 4%, com base na matéria seca, de óleo de babaçu (OBA) ou buriti (OBU). Os animais receberam a dieta em confinamento com duração de 60 dias, dez de adaptação e 50 experimentais. Após esse período foram submetidos a jejum de sólidos de 16 horas e abatidos. Dois contrastes foram avaliados: dieta controle versus dietas com óleos e óleo de babaçu versus óleo de buriti (P<0,05) e para os atributos relacionados à análise sensorial, utilizou-se teste de Kruskal-Wallis (P<0,05). Nas avaliações realizadas no animal, na carcaça e componentes não carcaça a inclusão do óleo de babaçu ou buriti não promoveu efeito (P>0,05) no peso vivo ao abate, peso da carcaça quente, peso da carcaça fria, quebra por resfriamento, pH final, área de olho de lombo, espessura de gordura, peso e rendimentos dos cortes, exceto paleta e costela e peso e rendimento de componentes não carcaça, exceto peso e rendimento do rúmen. O tratamento com óleo de babaçu reduziu o rendimento de carcaça quente e fria e aumentou o peso e rendimento do rúmen. O tratamento com adição de óleo de buriti diminuiu o rendimento da paleta e aumentou os da costela e gordura perirrenal. Nas avaliações realizadas no músculo Longissimus dorsi, a adição dos óleos vegetais não alterou (P>0,05) variáveis de luminosidade, intensidade de vermelho, intensidade de amarelo, perda de peso por cocção, capacidade de retenção de água, teor de proteína, concentração de ácidos graxos saturados, ácido rumênico (C18:2c9t11-CLA) e vacênico (C18:1t11) e não houve diferença (P>0,05) nas variáveis sensoriais da carne (cor, aroma, maciez, suculência e aceitação global). Entre os óleos, a dieta OBU aumentou (P<0,05) o teor de lipídios e reduziu a força de cisalhamento e teor de umidade da carne. A dieta OBA reduziu (P<0,05) a concentração de ácido graxo monoinsaturado-cis, porém aumentou (P<0,05) a concentração de ácido graxo monoinsaturado-trans, ácido graxo de cadeia média, ácido graxo de cadeia ramificada, intermediários da biohidrogenação, C18:1t10, relação t10:t11, TOTALC18:0, índice de atividade da enzima dessaturasestearoyl-CoA e ácido graxo poli-insaturado nos tecidos dos cordeiros e aumentou ácido graxo linoleico (C18:2n6) e araquidônico (C20:4n6), somente no músculo Longissumus dorsi, e CLAt10c12, somente no tecido adiposo subcutâneo. Óleo de babaçu ou buriti pode ser adicionado na dieta de cordeiros terminados em confinamento, sem importantes alterações nas características de carcaça, cortes comerciais e componentes não carcaça, o que promove carne de qualidade e boa aceitação. Adicionalmente, óleo de babaçu eleva o valor nutricional da carne, pelo aumento de ácido graxos desejáveis nos tecidos dos cordeiros e diminui os ácidos graxos totais.

  • JUSTO BERNARDO MARTINEZ FLECHA
  • SUPLEMENTAÇÃO ALIMENTAR DE MACHOS NELORE E F1 SENEPOL X NELORE, IMUNOCASTRADOS OU NÃO, TERMINADOS A PASTO

  • Data: 22/11/2019
  • Mostrar Resumo
  • A busca por alternativas que visem produtividade, qualidade, sustentabilidade e lucratividade, permite combinar tecnologias como cruzamentos, genética, condição sexuais e suplementação alimentar como estratégia de solução em sistemas de terminação a pasto. O objetivo de este trabalho foi avaliar o desempenho produtivo, econômico, características de carcaça e carne de machos Nelore (NE) e F1 Senepol x Nelore (SE), imunocastrados ou não, terminados a pasto com suplementação alimentar. O experimento foi conduzido na chácara Santa Luzia, em Araguaína – TO. Foram utilizados 28 machos, 14 NE e 14 SE, sendo que cada genótipo foram 7 imunocastrados (IC) e 7 não castrados (NC), terminados a pasto com capim Mombaça. Os animais ingressaram a experimentação com idade média de 12 – 14 meses e pesos inicial médio de 235,29 kg NE e 308,86 kg SE, utilizando-se um delineamento inteiramente casualizado em esquema fatorial 2 x 2 (genótipo x condição sexuais), distribuídos em quatro piquetes de 1 há cada, em sistema de pastejo continua e lotação fixa. O período experimental teve uma duração de 147, 168, 210 e 231 dias para SE NC, SE IC, NE NC e NE IC respectivamente. A suplementação foi de 1% no período das águas, 1,5% na transição água – secas e ad libitum no período seco. A coletas de amostras de capim e pesagem foram a cada 21 dias. A determinação de massa de forragem, acumulo e desaparecimento foram realizados por meio do sistema de triple emparelhamento. O abate foi realizado segundo as normas e regulamentações e continuando o fluxo normal do frigorifico comercial. Na avaliação durante o período de suplementação de 1% do PV, não houve diferença significativa (P>0,05) na interação genótipo e condição sexual (GExCS). Quando comparados entre genótipos, os SE apresentaram maior (P<0.05) peso vivo final (PVF), ganho de peso total (GPT), ganho médio diário (GMD), e menor ganho de peso em relação ao peso vivo inicial (GT) e eficiência de conversão de alimento (CA). No entanto, quando comparados entre condição sexual, os NC apresentaram maior (P<0.05) PVF, GPT, GMD, GT e melhor CA. Na avaliação durante o período de suplementação de 1,5%, houve interação entre GExCS (P<0,05) para as variáveis GPT, GMD e GT. Os SE IC apresentaram maior (P<0.05) GPT em relação aos SE NC. Os SE NC apresentaram maior (P<0.05) GMD em comparação aos NE NC e SE IC. Os SE NC apresentaram maior (P<0.05) GT quando comparados com NE NC. Os SE apresentaram maior (P<0.05) PVF, GT e melhor CA. Na avaliação geral dos períodos de suplementação, não houve interação entre GExCS. Os SE apresentaram maior (P<0.05) GMD, menor GPT, GT, CMN e melhor CA. Animais NC apresentaram maior (P<0.05) GMD, GT, menor CMN e melhor CA. Houve interação (P<0.05) entre o GExCS para rendimento de carcaça fria (RCF), em que NE NC apresentaram maior RCF (56,58%) em comparação aos SE IC, NE IC, SE NC com 55,07; 54,89; 54,36% respetivamente. Animais NC apresentaram maior (P<0.05) rendimento de carcaça quente (RCQ), quebra ao resfriamento (QR), espessura de gordura subcutânea (EGS). Os IC apresentaram maior (P<0.05) recorte de gordura (RG). Os NE apresentaram maior (P<0.05) RCQ e QR. Houve interação (P<0.05) entre o GExCS para traseiro especial (TE), em que SE IC apresentaram maior TE (47,13%) em comparação aos NE NC, NE IC, SE NC com 47,00; 46,41 e 45,97% respetivamente. Os SE apresentaram maior (P<0.05) peso de ponta de agulha (PA) e percentagem de musculo (M%). Os NC apresentaram maior (P<0.05) percentagem de dianteiro (DIA%) e M%. Houve interação (P<0.05) entre o GExCS para a* carne, pH final e força de cisalhamento (FC). Animais IC apresentaram maior (P<0.05) b* gordura, a* carne e b* carne. Os NC maior (P<0.05) FC.

  • JACKELINE DE OLIVEIRA MIRANDA
  • ANÁLISE MORFOMÉTRICA DOS ESPERMATOZOIDES DE MACACO-PREGO (Sapajus apella Linnaeus, 1758) RESFRIADOS EM ÁGUA DE COCO EM PÓ (ACP-118®) ASSOCIADO AO ANTIOXIDANTE TROLOX


  • Orientador : SHEYLA FARHAYLDES SOUZA DOMINGUES
  • Data: 08/10/2019
  • Mostrar Resumo
  • A análise morfométrica refere-se ao emprego de diferentes medidas em imagens captadas manualmente ou digitalmente, com objetivo de estimar e comparar mudanças estruturais em todos os tipos de células. O estudo da morfometria espermática, cuja finalidade é estimar e comparar mudanças estruturais no espermatozóide, é de fundamental importância para a compreensão da morfologia e função espermática. Estudos relacionados à reprodução do primata neotropical Sapajus apella, os apontam como um modelo biológico com grande potencial na biotecnologia de reprodução. Os objetivos do presente estudo foram: descrever e avaliar alterações na morfometria espermática em macacos-prego (Sapajus apella), antes e após a etapa de resfriamento do sêmen in natura diluído em água de coco em pó (ACP-118®) e com adição do antioxidante trolox (100 ou 150 µM), e também, verificar a relação das concentrações do antioxidante trolox com a morfometria espermática. Foram obtidas imagens de espermatozoides dos esfregaços de sêmen, corados com eosina/nigrosina, de seis indivíduos de S. apella (n = 6), mantidos em cativeiro no Centro Nacional de Primatas (Ananindeua-PA). Os espermatozóides foram mensurados quanto aos parâmetros da cabeça: área [A], perímetro [P], comprimento [L], largura [W]. As imagens foram gravadas pelo programa NIS Elements. Apenas os espermatozoides morfologicamente normais foram avaliados. As medições foram realizadas com o software Image J ® usando a ferramenta Threshold, Wand (rastreamento) e Straight (linha segmentada). Os dados foram avaliados utilizando a análise de variância (ANOVA), seguindo da diferença menos significativa pelo teste Student-Newman-Keuls (SNK) como teste post hoc, e um valor P <0,05 foi considerado como estatisticamente significativo. Foram encontrados os seguintes resultados, para um total de 7.537 células espermáticas medidas:  a) Antes do resfriamento, I (controle {ACP-118®}) A= 3.74 ± 0.24 µm2, P= 16.11 ± 1.03 µm, C= 1.35 ± 0.10 µm, L= 0.83 ± 0.08 µm; II (ACP-118® + Trolox 100 μg) A= 3.69 ± 0.25 µm2, P= 15.93 ± 1.07 µm, C= 1.33 ± 0.11 µm, L= 0.83 ± 0.8 µm; III (ACP-118® + Trolox 150 μg) A= 3.07 ± 0.28 µm2, P= 15.94 ± 1.17 µm, C= 1.34 ± 0.11 µm, L= 0.83 ± 0.12 µm; b) Pós resfriamento, I (controle {ACP-118®}) A= 3.45 ± 0.24 µm2, P= 14.99 ± 1.05 µm, C= 1.26 ± 0.11 µm, L= 0.78 ± 0.07 µm; II (ACP-118® + Trolox 100 μg) A= 3.46 ± 0.32 µm2, P= 15.06 ± 0.6 µm, C= 1.26 ± 0.13 µm, L= 0.81 ± 0.09 µm; III (ACP-118® + Trolox 150 μg) A= 3.44 ± 0.31 µm2, P= 14.36 ± 1.33 µm, C= 1.21 ± 0.14 µm, L= 0.78 ± 0.09 µm. Em conclusão, observamos que o resfriamento reduziu as dimensões da cabeça dos espermatozoides, e que a morfometria espermática pode ser usada como uma ferramenta complementar para as análises de sêmen, e também avaliar a criorresistencia de amostras a serem congeladas.

  • DIEGO FERNANDO DUBEIBE MARIN
  • METABOLISMO LIPÍDICO DE OÓCITOS E EMBRIÕES BUBALINOS PRODUZIDOS IN VITRO

  • Data: 18/09/2019
  • Mostrar Resumo
  • Os resultados da produção in vitro de embriões na espécie bubalina ainda se encontram aquém dos observados em outras espécies domesticas. A dificuldade em fornecer o microambiente adequado durante os processos de maturação, fecundação e desenvolvimento embrionário inicial, devido principalmente ao desconhecimento das necessidades metabólicas especificas para esta espécie, apresenta-se como um dos principais entraves para a implementação desta biotecnologia em escala comercial. Tem-se planteado a hipótese que os lipídios representam uma importante fonte endógena de energia indispensável para os processos de maturação oocitária e desenvolvimento embrionário inicial, assim, alterações no processo de β-oxidação lipídica afetam os processos de maturação oocitária e desenvolvimento embrionário em condições de cultivo in vitro. Para testar esta hipótese, no presente estudo objetivou-se avaliar o metabolismo lipídico de oócitos e embriões bubalinos maturados e cultivados in vitro. Para a realização dos diferentes experimentos, grupos de 10 CCOs bubalinos foram maturados, fecundados e cultivados em condições de laboratório. Na primeira parte do experimento, foi testado o efeito da suplementação com L-carnitina (3,03 mM) durante a maturação de CCOs em presencia ou ausência de soro fetal bovino (SFB). Posteriormente, o processo de β-oxidação foi estimulado durante a etapa da maturação e/ou durante o cultivo embrionário, mediante a suplementação dos meios de cultivo com L-carnitina (3,03 mM). Nas duas etapas foram avaliados os efeitos sobre as taxas de clivagem e produção de blastocistos. Finalmente, foi avaliado o efeito da suplementação com L-carnitina na presença ou ausência de SFB durante o período de maturação, sobre a expressão dos genes ACACA, FABP3, SCD, CPT1, e FASN, em células do cúmulus e oócitos, antes e depois do processo de maturação, e juntamente, buscando realizar analises comparativos, foi avaliada a expressão dos mesmos genes em oócitos e células do cúmulus maturados in vivo. Os dados Foram analisados mediante ANOVA, e as diferenças foram avaliadas pelo teste Tukey. O nível de significância para as diferentes avaliações foi de 5%. Os resultados preliminares mostram que CCOs maturados em meio de cultivo com SFB na presença de L-carnitina produziram uma menor taxa de embriões (p≤0,05) em comparação aos grupos controles. Por sua vez, a taxa de produção de blastocistos a partir de CCOs maturados com BSA-FAF na presença de L-carnitina foi similar em relação aos grupos controles (p≥0,05), e foi maior em comparação ao grupo suplementado com L-carnitina na presença de SFB (p≤0,05) (36,3±11,2; 34,7±9,5; 32,5±8,6 e 17,2±8,6; para os grupos BSA-FAF+L-carnitina, BSA-FAF controle, SFB controle, SFB+L-carnitina, respectivamente). A adição de L-carnitina durante o cultivo dos embriões não mostrou diferenças na produção de blastocistos entre os diferentes grupos avaliados (p≥0,05). Em conclusão, na presença de SFB, a suplementação do meio de maturação de CCOs bubalinos com L-carnitina na concentração de 3,03 mM diminui a taxa de produção de blastocistos, sugerindo que o aumento da β-oxidação dos ácidos graxos, na presença de uma fonte rica em estruturas lipídicas (SFB), afeta negativamente o metabolismo dos CCOs, diminuindo a competência dos oócitos bubalinos.

  • GUSTAVO ALIGHIERE LOPES DA SILVA
  • HORMÔNIO ANTIMULLERIANO COMO MARCADOR DA POPULAÇÃO FOLICULAR EM BÚFALAS (Bubalus bubalis) MULTIPARAS

  • Orientador : OTAVIO MITIO OHASHI
  • Data: 21/06/2019
  • Mostrar Resumo
  • O objetivo deste estudo foi avaliar se a concentração dos níveis de AMH apresentaria correlação com população folicular (PF) ovariana e se a PF ovariana apresentaria relação com a produção in vitro de embriões na espécie bubalina. Foram utilizadas 47 búfalas (Babalus bubalis) multíparas, 19 búfalas passaram por até 6 OPUs nas quais foram realizadas as contagens dos folículos ovarianos maiores que 3 mm, visando realizar a correlação entre a PF ovariana com os níveis de AMH. Um grupo com 28 búfalas passou por uma única OPU para coletar oócitos que serviram para FIV (fertilização in-vitro) com objetivo de fazer a correlação dos níveis de AMH e a produção in in-vitro de embriões. Ao final de cada OPU sempre foi feito a coleta de sangue para avaliação dos níveis de AMH. Foram divididos dois grupos de doadoras a partir da sua PF, sendo o grupo 1 constituído por doadoras que apresentaram PF acima da média geral e o grupo 2 com doadoras que apresentaram PF abaixo da média geral, posteriormente foi realizado a correlação da concentração de AMH e a PF de cada grupo. Para avaliar se havia correlação entre a produção de embriões e os níveis de AMH, foram separadas as doadoras de acordo com os grupos de PF estabelecidos anteriormente e correlacionados com a produção de embriões, estabelecendo uma relação com o nível de AMH. Todos os dados foram analisados na plataforma SAS University Edition (2019), sendo calculados a média e o desvio padrão, bem como, foi realizado Analise de Correlação de Pearson, para verificar a correlação entre o nível de AMH, população folicular, quantidade de oócitos aspirados, oócitos para FIV e oócitos viáveis. Os dados (população folicular, nível de AMH e produção in-vitro de embriões) foram submetidos a Análise de Variância (ANOVA) e as médias de foram submetidas ao Teste de Tukey, com nível de significância de 5%. Das 19 doadoras avaliadas foram obtidas médias de 194,74±95,17, 13,76±4,55, 8,64±6,13, 5,17±4,52 e 2,62±3,11 para o nível de AMH, população folicular, média de oócitos recuperados, média de oócitos para FIV e média de oócitos viáveis para FIV respectivamente. Em relação a correlação da população folicular com o nível de AMH foi obtido correlação positiva, r: 0.55 e p: <0,0001. Ao avaliar os grupos de produção folicular 1 e 2, foi obtido no grupo 1, 22 doadoras com médias de 18,71±4,37 e 192,67±78,43 para PF e AMH respectivamente e no grupo 2, 25 doadoras com médias de 9,91±2,41 e 149,26±66,9 para PF e AMH respectivamente. Foram observadas diferenças estatísticas (P< 0,05) entre os grupos apresentados. Na avaliação da relação da produção de embriões com o nível de AMH foi observado 28 doadoras dentro dos grupos 1 e 2 que produziram embriões. O grupo 1 com 13 animais apresentou média de 2,61±2,43 embriões e o grupo 2 com 15 animais apresentou média de 0,53±0,91 embriões. A avaliação entre os grupos apresentou diferença estatística (P< 0,05). Podemos concluir que o AMH pode ser utilizado como uma ferramenta para seleção de doadoras com maior produção folicular e assim selecionar fêmeas que venha apresentar melhores resultados em programas de produção de embriões in-vitro

  • FABRICIO NILO LIMA DA SILVA
  • Tortas e óleos de buriti (Mauritia flexuosa), coco (Cocos nuciferae dendê (Elaeis guineensesem dietas para tambaqui (Colossoma macropomum Cuvier, 1818)

  • Data: 07/06/2019
  • Mostrar Resumo
  • O objetivo deste estudo foi avaliar os efeitos das dietas contendo tortas e óleos de buriti (Mauritia flexuosa), dendê (Elaeis guineenses) e coco (Cocos nucifera) parajuvenis de tambaqui (Colossoma macropomum). No primeiro experimento, um total de210 juvenis de tambaqui (4,40 ± 0,28 g) foram dispostos em 21 caixas de polietileno, com capacidade de 100 litros. Sete dietas foram formuladas, sendo uma controle (sem o ingrediente alternativo) e seis testes (10% e 30% de torta de buriti, 10% e 30% de torta de dendê e 10% e 30% de torta de coco). Os tratamentos foram distribuídos em triplicatas e os animais foram alimentados até a saciedade aparente, seis vezes ao dia durante 60 dias. O desempenho, a composição corporal dos animais e os custos das dietas foram determinados ao final da fase experimental. No segundo experimento, 160 peixes(3,4 ± 0,4 g)foram distribuídos em 16 tanques de 250 litros. Quatro dietas foram formuladas utilizando diferentes óleos, dieta controle contendo óleo de soja (Glycine max) e três dietas teste: óleo de buriti; óleo de coco e óleo de dendê. O experimento foi realizado em delineamento inteiramente casualizado com quatro tratamentos e quatro repetições. Os peixes foram alimentados duas vezes ao dia, por 90 dias. O crescimento, a composição corporal, o perfil de ácidos graxos muscular e a morfometria do intestino e do fígado foram avaliados ao final da fase experimental. Não foram observadas diferenças entre o consumo alimentar total, consumo diário, taxa de crescimento específico, índice hepatossomático e fator de condição. O peso médio final, a biomassa, a eficiência proteica e a sobrevivência dos peixes alimentados com as dietas contendo 10% e 30% de buriti e dendê não diferiram estatisticamente, porém houve diferença quando comparados com as dietas contendo torta de coco e a controle (p<0,05). Não foram observadas diferenças para umidade, extrato etéreo ematéria mineralcorporal. O alto teor de proteína bruta no corpo foi registrado em peixes alimentados com as dietas contendo 30% de buriti e de dendê (p<0,05). Os melhores indicadores econômicos foram encontrados em dietas contendo torta de dendê. Os animais alimentados com óleo de buriti e dendê apresentaram aumento significativo (p<0,05) no peso médio final, sendo a melhor conversão alimentar e a taxa de eficiência proteica foram observadas nos peixes que receberam óleo de buriti. A quantidade de proteína bruta no músculo e na carcaça dos peixes foram significativamente maiores nos grupos que receberam óleo de buriti e dendê. A altura da vilosidade intestinal reduziu nos peixes alimentados com a dieta óleo de coco, enquanto aqueles alimentados com óleo de soja, buriti e dendê apresentaram aumento das vilosidades, sendo que a maior área total dos vilos foi proporcionada pela dieta óleo de buriti. A congestão sanguínea no fígado prevaleceu em todos os grupos e o tamanho dos hepatócitos não apresentaram diferenças significativas entre as diferentes fontes de dieta. A quantidade de ácidos poliinsaturados(PUFA) na muscuratura foi significativamente maior nos peixes alimentados com óleo de soja e buruti.A quantidade de eicosapentaenoico (EPA) no músculo não mostrou diferença significativas entre os tratamentos. Houve diferença (p˂0,05) para o docosahexaenoico (DHA), sendo mais altos em peixes alimentados com a dieta contendo óleo de dendê. Concluímos que os ingredientes dendê e buriti podem ser incluído em até 30% na dieta de tambaqui durante a fase juvenil. O óleo de buriti pode ser utilizado em dietas para tambaqui na fase juvenil, proporciona maior peso final, áreas e alturas das vilosidades quando comparados com as demais dietas. Óleos vegetais na dieta não afeta o fígado, no entanto, o óleo de buriti e dendê aumentou a deposição de proteína na carcaça e músculo dos animais. A maior composição em DHA e relação PUFA n-3 e n-6 muscular é alcançado com o uso do óleo de dendê.

     

  • RELMA DE ABREU PEREIRA
  • Balanço de compostos nitrogenados e estimativas de síntese de proteína microbiana em ovinos alimentados com dietas contendo diferentes fontes de lipídeos

  • Orientador : LUANA MARTA DE ALMEIDA RUFINO
  • Data: 29/04/2019
  • Mostrar Resumo
  • Objetivou-se avaliar a síntese de proteína microbiana a partir da excreção de derivados de purinas, o volume de excreções diárias de creatinina, bem como comparar os métodos de coleta de urina, sendo um período de coleta de seis dias consecutivos, utilizando a coleta de urina total nos primeiros cinco dias, com a coleta de urina spot no sexto dia, 4 horas após a alimentação. Foram utilizados 26 ovinos mestiços Dorper-Santa Inês, terminados em confinamento, com delineamento experimental em blocos inteiramente casualizado, com quatro tratamentos e sete repetições. Os animais foram alimentados com volumoso:concentrado, sendo a proporção 40:60, formuladas para serem isonitrogenadas. O volumoso (silagem de milho- Zea Mays), será fornecido com diferentes fontes de concentrado, onde cada fonte irá compor um tratamento, sendo o concentrado padrão (CP - soja farelo e milho grão) a dieta controle (TC - torta de cupuaçu), (TT - torta de tucumã) e (GOS - soja grão acrescida de óleo de soja). 

  • CELIA MARIA COSTA GUIMARAES
  • COPRODUTOS DO PROCESSAMENTO DA AMÊNDOA DO CUPUAÇU (Theobroma grandiflorum) E DO MURUMURU (Astrocaryum murumuru) NA ALIMENTAÇÃO DE OVINOS

  • Data: 04/04/2019
  • Mostrar Resumo
  • As tortas de cupuaçu (Theobroma grandiflorum Schum., Sterculiaceae) e murumuru (Astrocaryum murumuru Var. Murumuru Mart.) são resíduos da indústria cosmética e alimentícia, com características que possivelmente servem para uso como ingrediente alternativo e de  baixo custo na alimentação de ruminantes. Cada torta foi avaliada em um experimento. No experimento da torta de cupuaçu, milho moído e farelo de trigo foram substituídos no concentrado por níveis (0, 10, 20, 30 e 40%). As dietas foram formuladas para serem isonitrogenadas. No experimento com torta de cupuaçu, níveis crescentes desse resíduo foram utilizados para substituir parte da silagem de capim elefante (Penissetum purpurium) e do concentrado (a base de milho moído e farelo de soja), nos níveis de 0, 10, 20, 30 e 40%. Essas dietas foram formuladas para serem isonitrogenadas e isofibrosas. Foram avaliados o desempenho, o consumo, o comportamento ingestivo, rendimento e qualidade de carcaça, e realizada a análise sensorial da carne. Os experimentos foram executados com 25 ovinos sem raça definida (SRD) por experimento, em delineamento inteiramente casualizado, com cinco tratamentos e cinco repetições por tratamento. Os dados foram submetidos à análise de regressão, utilizando o pacote estatístico SAS. Para o experimento do cupuaçu, com exceção da profundidade do tórax e o acabamento da carcaça, não houve influencia (P>0,05) da inclusão da torta de cupuaçu nas demais variáveis estudadas. A inclusão de torta de cupuaçu até 40%, da matéria seca, no concentrado, em condições de alimentação deste experimento para ovinos, em confinamento, não altera o desempenho, rendimento, acabamento e qualidade de carcaça, constituindo assim, uma alternativa na composição da dieta para esses animais. No experimento com murumuru o consumo de matéria seca (CMS) kg/dia houve efeito linear negativo (P<0,05)e efeito quadrático para o CMS (%PV, % PV0,75,  kg/PV0,75). Contudo, o ganho de peso diário, conversão alimentar, rendimento carcaça quente, rendimento carcaça fria, espessura de gordura e área de olho de lombo não foram afetados (P>0,05) pelas inclusões da torta. Com exceção da profundidade do tórax, que apresentou efeito linear decrescente (P<0,05), as demais medidas morfométricas da carcaça, não houve efeito significativo (P>0,05). No comportamento ingestivo, não foi observado efeito para ruminação. No entanto, para alimentação e ócio houve efeitos contrários, para alimentação a torta reduziu linearmente o tempo gasto, e para o ócio houve aumento linear no tempo dispêndio. Na avaliação sensorial identificou-se que a dieta com 40% de substituição pela torta de murumuru apresentou a menor pontuação em relação aos outros níveis (P<0,05).  A torta de murumuru representa uma alternativa viável para compor dietas de ovinos confinados. Inclusões de até 40% não interferem no desempenho dos animais. Características organolépticas não são afetadas quando há participação da torta em até 30% na dieta. Portanto, o uso de torta de murumuru nas dietas de cordeiros é recomendado nos níveis e condições de estudados desse trabalho, isto é, particularmente para dietas cujo ganho não seja superior a 150g.

  • VANESSA CUNHA DE BRITO
  • IMUNOLOCALIZAÇÃO DE AMH E MORFOMETRIA EM TESTÍCULOS DE FETOS BOVINOS

  • Orientador : OTAVIO MITIO OHASHI
  • Data: 29/03/2019
  • Mostrar Resumo
  • O hormônio anti-Mülleriano (AMH), também conhecido como Muller Inhibitory Substance (MIS), é expresso pelas células de Sertoli do testículos fetais. O AMH desempenha um papel importante na indução da regressão dos ductos de Muller no feto masculino, desencadeando na diferenciação sexual, entretanto seu papel no desenvolvimento gonadal ainda requer mais investigações. O objetivo deste trabalho foi realizar a morfometria dos túbulos seminíferos e a quantificação celular, com posterior análise da imunolocalização de AMH em fetos bovinos de diferentes idades com o intuito de investigar o papel do hormônio durante o desenvolvimento gonadal. Treze pares de testículos de fetos bovinos de idades de 4 a 8 meses (24-98 CRL) foram coletados em abatedouro local, fixados em 10% de formaldeído durante 24 horas, processados para histologia convencional e incluídos em parafina. Para a morfometria e quantificação celular os cortes histológicos de 5µm foram corados com hematoxilina e eosina. Para a imunolocalização de AMH, os cortes foram desparafinizados, rehidratados e incubados com o anticorpo anti-AMH (SC 28912) de acordo com instruções do fabricante, e em seguida revelados com DAB e corados com Hematoxilina. As lâminas foram visualizadas utilizando o fotomicroscópio Eclipse Ci-E (Nikon Corporation, Tóquio, Japão) e o software NIS-Elements Basic Research - NIKON Versão 4.0. A anise estatística foi realizada utilizando-se o teste ANOVA com um nível de significância de 5%, e pós-teste de Tukey no software SigmaPlot 12.1. Os resultados foram apresentados em média ± s.d. para diâmetro tubular de 47,5 (± 5,1), 47,1 (± 4,5), 43,7 (± 3,9), 48,2 (± 4,2) e 42,1 (± 3,2) μm; células de Sertoli de 7,4 (± 6,2), 11,7 (± 2,2), 12,8 (± 1,9), 12,6 (± 1,7) e 11,8 (± 1,9), e número de gonócitos 1,4 (± 0,8) 1,1 (± 0,7), 0,6 (± 0,7 ), 1,5 ± 0,7 e 0,9 (± 0,6) visualizados em 4, 5, 6, 7 e 8 meses, respectivamente. Como resultado, o diâmetro tubular não aumentou entre 4 e 5 meses, porém aos 6 e 8 meses os menores diâmetros foram observados. Quanto à quantificação das células de Sertoli, observou-se aumento gradual e significativo entre 4 e 7 meses (p <0,05). Além disso, as idades fetais mostraram diferença significativa no número de células de Sertoli e germinativas (p <0,05). No entanto, não há estudos na literatura sobre idade fetal e proporção de células de Sertoli e números de células germinativas. A imunomarcação foi observada nas células de Sertoli, dentro dos cordões sexuais (túbulos seminíferos em desenvolvimento) em todas as idades e não foi observado nos gonócitos e tecido intersticial. Considerando-se que o papel AMH no desenvolvimento gonadal não é bem compreendido, este é o primeiro relato da imunolocalização de AMH em testículo de fetos bovinos com idade gestacional mais avançada e mostrou a produção de AMH durante o desenvolvimento fetal masculino. Estudos futuros poderiam elucidar os mecanismos moleculares da proteína AMH no desenvolvimento testicular e na fisiologia de fetos bovinos.

  • ALEXANDRE DA SILVA CUNHA
  • CARACTERIZAÇÃO DOS SISTEMAS PRODUTIVOS E DOS PRODUTORES DE LEITE DA REGIÃO LAGO DE TUCURUÍ, PARÁ, BRASIL

  • Data: 22/03/2019
  • Mostrar Resumo
  • O objetivo do trabalho foi caracterizar o sistema de produção leiteira e os produtores rurais da Região de Lago de Tucuruí, composta pelos municípios de Breu Branco, Goianésia do Pará, Itupiranga, Jacundá, Nova Ipixuna, Novo Repartimento e Tucuruí. Foram entrevistados 66 produtores, submetidos a um questionário contendo questões de múltipla escolha e discursivas onde foram abordados aspectos sanitários e produtivos dos animais e socioeconômicos dos produtores. Como resultados pode-se observar que a média de idade dos proprietários rurais foi de 54 anos entre os homens e 46 anos entre as mulheres. O grau de instrução foi baixo, 74,2% não concluíram o ensino fundamental. O principal entrave na atividade foi o preço baixo do leite. Os principais problemas sanitários enfrentados foram carrapatos, diarreia em bezerros e afecções podais. A produtividade média das vacas foi de 3,95 litros de leite/vaca/dia. Portanto são necessárias políticas públicas voltadas para a assistência técnica e educação do homem do campo que permitam adquirir o conhecimento necessário na melhoria dos índices produtivos.

  • FILIPE LUIGUI SOARES DA COSTA
  • COMPARAÇÃO DE LIDOCAÍNA 2% ASSOCIADA À LEVOBUPIVACAÍNA 0,5% SEM VASOCONSTRITOR COM OU SEM MORFINA UTILIZADAS POR VIA EPIDURAL EM BÚFALAS PARA ANESTESIA LOCORREGIONAL– PROJETO DE PESQUISA

  • Data: 15/03/2019
  • Mostrar Resumo
  • Este trabalho avaliará a técnica anestésica epidural pela anatomia da região sacrococcígea e analisará a resposta fisiológica das búfalas frente as ações farmacodinâmicas do cloridrato de lidocaína 2% e levobupivacaína 0,5% associados ou não a morfina, buscando saber se permitirão a laparoscopia pelos flancos e coleta de fragmentos hepáticos e ovarianos para biópsia.A avaliação da resposta fisiológica será feita destacando o período de latência anestésica; intensidade de bloqueio motor e bloqueio sensitivo;frequência cardíaca, respiratória e de movimentos ruminais e temperatura retal;intensidade de bloqueio sensitivo, frequência cardíaca e respiratória no momento exato da incisão do flanco, da inflação com CO2 no abdome, da coleta do fragmento hepático e ovariano, da desinsuflação do CO2 e da sutura. Serão utilizadas 10 búfalas mestiças MurrahxMediterrâneo. Cada búfala será pesada por um cálculo a partir do perímetro torácico. Após a epidural, serão avaliados frequência cardíaca, respiratória e de movimentos ruminais, temperatura retal antes e depois do ato anestésico, e escore de bloqueio motor e sensitivo e duração de bloqueio nervoso durante o trans-anestésico até finalizar o período anestésico e cirúrgico. O primeiro tratamento será a administração por via epidural de 0,1mg/Kg de cloridrato de lidocaína 2% associada a 0,0625mg/Kg de cloridrato de levobupivacaína 0,5% e o segundo tratamento corresponderá ao mesmo protocolo anterior associado ao sulfato de morfina na dose de 0,05mg/Kg diluída em 0,05mL de soro/Kg. Para determinar o período de latência, o estímulo doloroso por pinçamento será adotado na região do flanco até o surgimento do bloqueio sensitivo. Para o escore de bloqueio motor, será observado o relaxamento da musculatura da região do flanco e permanência quadrupedal. O período de bloqueio sensitivo será mensurado a partir do momento em que as búfalas não reagirem aos estímulos dolorosos na região do flanco até o momento de retorno doloroso no flanco. A sensibilidade dolorosa será avaliada a partir da provocação de estímulos dolorosos com a pinça de Kelly pelo flanco até que cesse o bloqueio anestésico. A frequência cardíaca, respiratória e de movimentos ruminais, assim como a temperatura retal serão mensurados no pré e trans-anestésico até o final do bloqueio.

  • PRISCILLA DO CARMO DE AZEVEDO RAMOS
  • SUPLEMENTAÇÃO HORMONAL DAS CÉLULAS EPITELIAIS DA TUBA UTERINA NA PRODUÇÃO IN VITRO DE EMBRIÕES BUBALINOS

  • Orientador : OTAVIO MITIO OHASHI
  • Data: 28/02/2019
  • Mostrar Resumo
  • O epitélio do oviduto produz moléculas que contribuem para a interação entre os gametas e a regulação das fases iniciais do desenvolvimento embrionário, além de possuir um ambiente que mantém a viabilidade dos espermatozoides, modulando a subpopulação que inicia o processo de capacitação, evitando a reação acrossômica prematura e a poliespermia. Alguns fatores secretados pelo epitélio do oviduto foram identificados em diferentes espécies de mamíferos e os efeitos da secreção uterina no processo reprodutivo podem resultar da ação combinada (inibidora ou estimuladora) de muitos fatores presentes no lúmen do oviduto em diferentes fases do ciclo ovulatório e da presença de gametas ou embriões. Considerando as características morfofisiológicas das células do oviduto, propõem – se com este trabalho estimular in vitro essas células com o uso de estrógeno e progesterona, simulando dessa forma o ciclo ovulatório e promovendo assim seus efeitos sobre a fecundação oocitária e o cultivo embrionário in vitro.

  • BRUNA ALMEIDA DA SILVA
  • Dietas alternativas na qualidade da carne e patê de figado de cordeiros, e avaliação toxicológica subcrônica em ratos.

  • Data: 28/02/2019
  • Mostrar Resumo
  • O objetivo o trabalho foi avaliar a inclusão de dietas alternativas na qualidade da carne e patê de fígado de cordeiros, e nos parâmetros toxicológicos sub crônicas em ratos. Foram utilizados 24 cordeiros machos. As dietas foram constituídas de volumoso a base de silagem de milho (40%) e concentrado (60%), com substituições parciais de milho e farelo de soja por 45% de torta de cupuaçu, 30,9% de torta de dendê e 17,6% de torta de tucumã, fornecidas durante 84 dias. Após o período de alimentação os animais foram abatidos e coletado Longissimus lumborum, e para produção dos patês foram coletados fígado e gordura omental. A qualidade das carnes e patês foram avaliados pelas análises físico-químicas, microbiológicas e sensoriais. Para determinar os parâmetros toxicológicos foram utilizados 50 ratos da linhagem Wistar, com 25 machos e 25 fêmeas. O grupo controle foi alimentado com ração comercial e os demais tratamentos com inclusões de patês de fígado de cordeiros, durante 30 dias, em seguida os animais foram anestesiados e o sangue e fígado coletados para as análises bioquímicas e histológicas e submetidos a eutanásia. As dietas influenciaram (P ˂ 0,05) nos teores de lipídeos, proteínas, valor calórico, perda de peso por cocção, cor e textura instrumental das carnes de cordeiros e que apenas a maciez e suculência diferiram segundo avaliação sensorial. A melhor condição de processo do patê foi com 40% de fígado, 10% gordura, 35% de água e 65ºC por 20 minutos de pasteurizado. A umidade, lipídeos, proteínas, carboidratos, valor calórico e cor dos fígados diferiram, e o maior teor lipídico de 4,86% e menor de carboidratos 2,74% foram encontrados nos tratamentos com torta de tucumã. O patê elaborado com fígado de cordeiro alimentados com torta de dendê, obteve o maior valor calórico 193,05 kcal/100g e todos os produtos atenderam a qualidade microbiológica preconizada pela legislação. Nos parâmetros sensoriais foi observado efeito significativo no aroma de fígado e dureza. As dietas também influenciaram nos triglicerídeos dos ratos com teor máximo 89,6 (mg/dL) e amilase, 567,2 (U/L) e nas fêmeas o valor de 172,8 (U/L) de transaminase glutâmico pirúvica - TGP foi significativo (P < 0,05), no tratamento com patê de cordeiro alimentado com torta de dendê. O colesterol total apresentou variação de 53,6 a 58,8 (mg/dL) nos machos e 60,6 a 69,8 (mg/dL) nas fêmeas. As dietas não influenciaram significativamente nos níveis de glicemia dos animais, no entanto, as com inclusão de patês, nos machos e fêmeas foram obtidos os maiores valores. O uso de tortas em dietas podem ser consideradas uma fonte alternativa de ingredientes na alimentação de cordeiros, pois contribuem com as propriedades nutricionais, físico-químicas e sensoriais das carnes e patês de fígado e que o patê de acordo com as quantidades inseridas na alimentação, não apresentaram toxicidade sub crônica, apesar dos níveis elevados de triglicerídeos e amilase nos machos e no TGP, das fêmeas, as dietas não alteraram as estruturas das células hepáticas.

  • ROGÉRIO DOS SANTOS CRUZ REIS
  • ASPECTOS TECNOLÓGICOS E ECONÔMICOS DE UM EMPREENDIMENTO COMUNITÁRIO DE OSTREICULTURA NO LITORAL AMAZÔNICO

  • Data: 28/02/2019
  • Mostrar Resumo
  • A criação de ostras pode ser uma alternativa viável de geração de emprego e renda para comunidades litorâneas brasileiras, visto que a tecnologia de produção destes organismos é relativamente simples e demanda um baixo investimento se comparado a outras atividades aquícolas. O objetivo deste estudo é analisar aspectos tecnológicos e econômicos de um empreendimento comunitário de ostreicultura no litoral amazônico, visando contribuir para a sua sustentabilidade. Para isso, a dissertação será dividida em três capítulos: 1. Desempenho zootécnico de ostras produzidas em mesas fixas e flutuantes em um empreendimento comunitário no litoral amazônico; 2. Custo de produção e rentabilidade de um empreendimento comunitário de ostreicultura no litoral amazônico; e 3. Consumo de ostras no estado do Pará: um estudo baseado na comercialização de um empreendimento comunitário de ostreicultura. No capítulo 1, serão selecionados seis travesseiros no empreendimento, sendo três instalados em mesas fixas (tratamento controle) e três em mesas flutuantes (tratamento teste). A origem das formas jovens, a densidade de estocagem e o manejo serão padronizados por oito meses, período que compreende um ciclo de produção da ostra classificada como baby. Em seguida, serão analisados e comparados: ganho de comprimento das ostras e taxa de sobrevivência nos travesseiros. No capítulo 2, será adotada a metodologia do custo operacional e indicadores de eficiência econômica para estimar o custo de produção e a rentabilidade do empreendimento a partir de dados obtidos no período de agosto de 2016 a julho de 2017. No capítulo 3, serão aplicados questionários aos consumidores e proprietários de estabelecimentos que comercializem ostras dos municípios de Augusto Corrêa, Belém, Bragança e Salinópolis, a fim de verificar: frequência de consumo, preferências e perfil socioeconômico dos consumidores, visando estabelecer estratégias capazes de maximizar a demanda por esse molusco.

  • RAYETTE SOUZA DA SILVA
  • FARELO DE PALMISTE (Elaeisguineensis) EM DIETAS PARA TAMBAQUI (Colossoma macropomum, CUVIER, 1818)

  • Data: 27/02/2019
  • Mostrar Resumo
  • O tambaqui (Colossoma macropomum, CUVIER, 1818), nativo da Amazônia, é a segunda espécie mais cultivada no Brasil, apesar de existirem poucos estudos relacionados à sua alimentação com coprodutos da agroindústria. Nesse contexto, a agroindústria do dendê (Elaeis guineensis) no Pará, pela sua destacada área plantada, disponibiliza grande quantidade de coprodutos, que podem ser usados em rações. Entretanto, a utilização segura de um ingrediente alternativodepende da obtenção de bons índices de desempenho zootécnico, além da avaliação da sua digestibilidade, efeito sobre a qualidade da carne e eficiência econômica. Dessa forma, esta pesquisa objetivou avaliar a qualidade nutricional do farelo de palmisteemtambaquis a partir da realização de duas etapas. A primeira etapa reuniu os resultados de dois experimentos. No experimento 1, em sistema fechado (recirculação), 120 tambaquis (16,35 ± 0,61 g) receberam cinco dietas com 0, 25, 50, 75 e 100% de substituição de milho pelo farelo de palmiste durante 75 dias, sendo avaliados o desempenho, variáveis hematológicas e bioquímicas e composição do músculo. A dieta com 25% de substituição promoveu melhor biomassa final, enquanto que em T75 e T100 houve prejuízos na conversão alimentar, no aproveitamento da proteína dietética e os níveis de colesterol plasmático e de neutrófilos revelaram alterações significativas no metabolismo animal. No segundo experimento, em sistema aberto (viveiros de terra), 240 peixes (15,52 ± 1,84g), receberam duas dietas com 0 e 25% de substituição (que promoveu melhor biomassa no experimento 1) durante 184 dias, sendo avaliados os efeitos no desempenho, eficiência econômica, rendimento de quatro formas de comercialização (eviscerado, tronco limpo, lombinho e costela) e características físicas e químicas do músculo. Nestas condições semelhantes a um cultivo comercial, a proporção testada não comprometeu as variáveis testadas, se apresentando como uma alternativa segura, além de reduzir o percentual de gordura no músculo e apresentar eficiência econômica, desde que o preço de obtenção do coproduto não ultrapasse 26,4% do preço do milho. A segundaetapa avaliou a digestibilidade dofarelo de palmiste, em duas fases de vida do tambaqui, fase 1 (4,45 ± 1,18 g) e fase 2 (115,91 ± 4,01 g), sendo demonstrado que o peso corporal não interferiu na capacidade do tambaqui em digerir o farelo de palmiste e o aproveitamento da proteína foi considerado satisfatório (63,29%), o que faz deste ingrediente uma potencial fonte alternativa de proteína em rações para a espécie.

  • NATALINO DA COSTA SOUSA
  • Doenças parasitarias de peixes ornamentais comercializados: identificação, distribuição e seus fatores de riscos.

  • Data: 27/02/2019
  • Mostrar Resumo
  • O gerenciamento dos fatores de risco nos empreendimentos comerciais é fundamental para mitigar e controlar a proliferação e a disseminação de doenças em peixes ornamentais, porém, não se conhece o verdadeiro valor que cada risco apresenta para aumentar as chances de doenças nos peixes, podendo ocasionar surtos de mortalidade e aumento nos custos de produção. Desta forma, o objetivo do presente estudo foi realizar estudos parasitológicos em estabelecimentos comerciais no estado de Sergipe e Pará, identificando e quantificando os fatores de riscos associados aos agentes patogênicos. Para tanto, no estado de Sergipe, foram coletados, bimestralmente entre novembro de 2015 a agosto de 2017, as espécies Pterophyllum scalare, Betta splendens, Xiphophorus maculatus, Poecilia reticulada e Carassius auratus em três pisciculturas e três lojas de aquarismo. No estado do Pará, foram coletados, bimestralmente entre abril de 2017 a Dezembro de 2018, as espécies Pterophyllum scalare, Symphysodon aequifasciatus, Paracheirodon axelrodi, Hyphessobrycon eques, Baryancistrus xanthellus, Ancistrus ranunculus, Xiphophorus hellerii, carassius auratus; Poecilia reticulada e Nannostomus unifasciatus em três exportadoras e três lojas de aquarismo. Durante as coletas, foram aferidos os parâmetros físico e químicos da água e aplicado questionário para a caracterização do empreendimento, manejo, nutrição e doenças. Para análises parasitológicas, os peixes foram eutanasiados e sacrificados por concussão cerebral e então, realizado exame macroscópico detalhado na superfície do corpo e microscópico, com a confecção lâmina-lamínula de muco, brânquias e órgãos internos (fígado, rim, estomago, intestino, e músculo) com solução salina a 0,65%. Posteriormente os parasitas foram quantificados, coletados e identificados ao menor nível taxonômico possível. Para tanto, no estado de Sergipe, foram coletados, bimestralmente entre novembro de 2015 a agosto de 2017, as espécies Pterophyllum scalare, Betta splendens, Xiphophorus maculatus, Poecilia reticulada e Carassius auratus em três pisciculturas e três lojas de aquarismo. No estado do Pará, foram coletados, bimestralmente entre abril de 2017 a Dezembro de 2018, as espécies Pterophyllum scalare, Symphysodon aequifasciatus, Paracheirodon axelrodi, Hyphessobrycon eques, Baryancistrus xanthellus, Ancistrus ranunculus, Xiphophorus hellerii, carassius auratus e Poecilia reticulada em três exportadoras e três lojas de aquarismo. Durante as coletas foi aplicado questionário para identificar as características do empreendimento que possam estar associadas às doenças parasitárias. Em laboratório, foram realizadas análises macroscópicas e microscópicas de 3.355 (oriundos dos estabelecimentos de Sergipe) e 2.140 peixes (oriundos do estado do Pará). A fauna parasitária dos peixes ornamentais foi composta de Ichthyophthirius multifiliis, Trichodina sp., Epistylis sp., Piscinoodinium pillulare, Myxobolus sp., Henneguya sp., Dactylogyrus sp., Gyrodactylus sp., Sciadicleithrum e Gussevia spiralocirra, Dactylogyrus intermedius, Clinostomum (metacercaria), Austrodiplostomum (metacercaria), larvas de Camallanus, Capillaria pterophylli, Cucullanus sp., Procamallanus (S) inopinatus e a ocorrência de Dermocystidium sp. somente na espécie N. unifasciatus. Para o estado de Sergipe, a maior prevalência observada foi para os monogenéticos na piscicultura para as espécies P. scalare (28,71±3,42), B. splendens (16,30±2,20) e P. reticulata (14,97±2,43) em relação a loja, com maior intensidade média para a Trichodina (12,18±2,90) e I. multifiliis (8,63±3,04) na espécie C. auratus. Em relação ao gerenciamento de risco, observou-se que o aumento de densidade de estocagem, compartilhamento de matérias (puçá, rede) e falta de higienização dos utensílios estão associados aos agentes patogênicos em todas as espécies nos dois estabelecimentos comerciais, ao qual, a falta de higienização aumenta as chances de doenças causadas por I. multifiliis em 18,22 vezes para P. scalare na piscicultura. Já para o estado do Pará, a maior prevalência (16,46±2,66%) e intensidade média (19,73±2,36) foram observadas para I. multifiliis parasitando a espécie P. axelrodi na loja, nas exportadoras a maior prevalência foi observada para o monogenético (13,39±1,16) em B. xanthellus (L18) e intensidade média para o parasito I. multifiliis (9,33±0,51) em S. aequifasciatus. Em relação aos riscos, o compartilhamento de utensílios aumenta as chances de doenças causadas por I. multifiliis em 4,29 vezes, já a densidade de estocagem aumentar a infestação de monogenéticos em B. xanthellus em 2,99 vezes, sendo observado para a espécie P. reticulata o risco de quatros fatores, com valores entre 1,88 a 4,02, para a doença causada por I. multifiliis. Já para a ocorrência Dermocystidium, foi o primeiro registro deste parasito em peixe ornamental amazônico, com prevalência de 55,8% e intensidade média de 3,38. Portanto, a quantificação dos fatores de risco associado às doenças parasitárias nos empreendimentos comerciais proporciona uma melhor gestão de risco sanitário podendo minimizar a proliferação de agentes patogênicos e a sua disseminação entre os elos da cadeia produtiva, melhorando a qualidade sanitária dos peixes.

  • MÁRCIA VALÉRIA SILVA DO COUTO
  • ÓLEO DE COCO VIRGEM COMO ALIMENTO NUTRACÊUTICO NA CRIAÇÃO DO TAMBAQUI Colossoma macropomum

  • Data: 27/02/2019
  • Mostrar Resumo
  • O presente trabalho objetivou avaliar os efeitos do óleo de coco virgem no desempenho zootécnico e sanitário de tambaqui e sua ação antimicrobiana. Para tanto, foram realizados teste in vitro utilizando o óleo de coco contra Ichthyophthirius multifiliis, Aeromonas hydrophila e Saprolegnia parasítica para avaliação dos seus efeitos antimicrobianos. Além disso, juvenis de tambaquis de tambaquis (n=360; 3,03±0,65g e 5,64±0,50cm) foram distribuídos em um delineamento contendo seis dietas experimentais com níveis crescentes de substituição de óleo de soja pelo óleo de coco virgem (OCV - 0%-T1, 25%-T2, 50%-T3, 75%-T4 e 100%-T5) mais uma dieta contendo 15% de ácido láurico (T6 - principal ácido graxo do óleo de coco), todos com 3 repetições, durante 90 dias. Biometrias mensais foram realizadas para avaliação do desempenho zootécnico e ao final do experimento os peixes (n=72) foram sacrificados para avaliação da composição corporal e índice hepato, espleno e viscerossomático. No momento da biometria final também foram realizadas coletas sanguíneas dos peixes (n=108) para medição de triglicerídeos, colesterol e proteínas plasmáticas totais. Após a suplementação dietética, 96 peixes (20,42±3,34g e 9,23±0,49cm) foram injetados intraperitonealmente com Aeromonas hydrophila, na concentração 1 x 108 UFC.g-1, e então distribuídos em recipientes com 10L de água em sistema estático e oxigenação constante, na densidade de 4 peixes/repetição. Foram desafiados com o patógeno 12 peixes de cada tratamento (T1 a T6), além de 12 peixes sem injeção (CSI) e 12 peixes somente com solução salina estéril (CSS), que constituíam os controles experimentais, todos com três repetições. Foram realizadas observações durante 10 dias, determinando a mortalidade acumulada a cada 24h, os sinais clínicos típicos da aeromoniose e classificação da intensificação da infecção. Alíquotas de sangue foram coletadas para avaliação dos metabólitos, eritrograma, leucograma e tombograma dos peixes durante e após 10 dias do desafio patogênico. Os dados foram avaliados quanto a sua normalidade e submetidos ao teste de homocedasticidade. Após verificação da normalidade os dados foram submetidos a análise de variância (ANOVA) e sendo F significativo as médias foram comparadas pelo teste de Tukey a 5% de probabilidade. Dados que não atenderam as premissas da ANOVA foram submetidos ao teste não paramétrico de Kruskal-Wallis e posteriormente ao teste de DUNN para comparação dos postos. O ácido láurico mostrou efeito fungistático a partir de 400mg/L e diminuição da contagem bacteriana a partir de 1g/L, já para o íctio o ácido láurico promoveu mortalidade a partir de 40mg/L, enquanto que o óleo de coco apresentou influência na velocidade de crescimento do fungo, não apresentou efeitos sobre a bactéria e apesar de alterar a morfologia do íctio permitiu o desenvolvimento de formas terontes. Os peixes suplementados apresentaram melhoria no desempenho zootécnico somente a partir de 60 dias de alimentação com maiores valores para peso final, ganho de peso, biomassa e ganho em biomassa. No entanto, ao final de 90 dias, os juvenis de tambaqui alimentados com rações contendo 50% e 75% de OCV apresentaram os maiores valores de peso final, biomassa, ganho de biomassa, ganho de peso, taxa de crescimento específico para peso e uniformidade para peso. Os peixes dos diferentes tratamentos não apresentaram diferença estatística entre os tratamentos para o índice viscerossomático, hepatossomático e esplenossomático. Em relação composição centesimal, a quantidade de proteína bruta corporal nos juvenis de tambaquis, após experimento, foi maior nos peixes dos tratamentos alimentados com 50% e 75% de OCV na dieta, sendo os menores valores encontrados para os peixes alimentados com 25% de OCV e para os das dietas contendo 100% de OCV. A matéria seca apresentou elevação à medida que os níveis de óleo de coco aumentaram na dieta. Já o teor de extrato etéreo e as cinzas não diferiram entre os tratamentos. Em relação aos metabólitos plasmáticos o colesterol e triglicerídeos diminuíram com dietas contendo ácido láurico e 50% de OCV, enquanto que o índice glicêmico aumentou e as proteínas totais não se alteraram. A alimentação dos tambaquis com óleo de coco virgem (OCV) influenciou positivamente na resistência dos peixes e no aparecimento dos sinais clínicos quando adicionado 25%, 50% e 75% de OCV à ração durante 192 horas. No entanto, a incorporação  com 100% de OCV apresentou 100% de mortalidade após 48 horas de infecção. Os sinais clínicos da aeromoniose encontrados nos peixes desafiados não foram observados apenas nos tratamentos com 25% e 50% de adição de óleo de coco, assim como nos tratamentos controles. Os tratamentos OCV apresentaram maiores valores de proteínas plasmáticas totais e glicemia em resposta ao desafio com A. hydrophila quando comparados aos peixes alimentados com 0% de OCV e ácido láurico, apresentando menores valores de lactato com 25% e 50% de suplementação. A infecção ocasionou anemia hemolítica nos com 0%, 25% e 100% de OCV, além do ácido láurico, com melhores respostas a aeromoniose dos peixes alimentados com 50% de OCV. Desta forma, é possível assumir que o animal alimentado com a ração suplementada com óleo de coco apresenta benefícios ao desempenho zootécnico e sanitário do tambaqui, recomendando-se a adição de 50% de OCV. Além do que, o ácido láurico apresenta efeitos in vitro contra patógenos de peixes.

  • BIANCA RAFAELA COSTA SILVA
  • Diferentes relações volumoso:concentrado em dietas com óleo residual de fritura para alimentação de ovinos

  • Data: 27/02/2019
  • Mostrar Resumo
  • A intensificação da utilização de concentrado nos sistemas de produção de carne ovina, tem promovido o desenvolvimento de pesquisas voltadas a busca de alimentos que possam baratear o custo da alimentação ou adensar os nutrientes na dieta, como a suplementação lipídica. No entanto, é conhecido que há um limite de utilização de extrato etéreo na dieta de ruminantes, pois pode promover efeitos deletérios, principalmente em dietas com menor proporção de concentrado, sendo assim, objetivou-se avaliar os níveis de concentrado (30, 45, 60 e 75%) em dietas contendo óleo residual de fritura (4% com base na MS) na alimentação de cordeiros Santa Inês sobre as variáveis consumo, digestibilidade e comportamento ingestivo. Foram utilizados 24 ovinos, com 4 meses de idade e peso corporal de 22 kg ±2kg, distribuídos em delineamento em blocos ao acaso, de acordo com o peso e confinados em gaiolas metabólicas individuais, onde receberam as dietas experimentais, contendo os níveis crescentes de concentrado. Os consumos de MS, MO e constituintes nutricionais sofreram efeito dos níveis de concentrado, com exceção do CFDN, com média de 1,46% do PV. Houveram aumentos lineares dos CMS, CMO, CPB, CEE e CCNF e redução linear do CFDA à medida que o nível de concentrado foi aumentado, apresentando redução de 0,0054%PV a cada 1% de acréscimo na proporção de concentrado. Os coeficientes de digestibilidade aparente (CD) da MS, MO e CNF não foram alterados pelos níveis de concentrado, ao passo que os CDPB, CDEE, CDFDN e CDFDA diminuíram linearmente com o nível de concentrado na dieta. O tempo de alimentação não foi afetado pela dieta, no entanto houve redução do tempo de ruminação, assim como TMT e o MMtb, aliado ao aumento do tempo dispendido em ócio.  As eficiências de alimentação da MS e de ruminação da MS e FDN aumentaram linearmente. Concluiu-se que os níveis até 75% de concentrado em dietas com inclusão de óleo residual de fritura não interferem negativamente nos consumos de nutrientes e, apesar da redução da digestibilidade de alguns nutrientes, houve compensação no consumo, haja vista que a eficiência alimentar e de ruminação foi aumentada.

  • SAMANTA DO NASCIMENTO MONTEIRO
  • Algoritmos de regressão de aprendizado de máquina para predição de músculo, osso, gordura de carcaça e cortes primários em cordeiros deslanados


  • Data: 26/02/2019
  • Mostrar Resumo
  • Em virtude do crescente desenvolvimentos de técnicas de automação na indústria da carne e a necessidade em se obter respostas com maior velocidade e padronização, objetivou-se com este estudo predizer características teciduais da carcaça e de cortes comerciais a partir de mensurações obtidas por VIA - vídeo image analysis, realizadas em carcaças frias de cordeiros deslanados, utilizando três técnicas regressivas de aprendizado de máquina para a formação de modelos preditivos, Stepwise, LASSO e Elastic Net. Foram utilizadas informações de 72 carcaças de animais machos castrados, com idade entre 8 e 11 meses, e peso de carcaça fria de 16,13±3,98 kg. Após o período de resfriamento as carcaças foram imageadas e as fotos armazenadas para posterior processamento com o software ImageJ2, onde foram demarcadas três diferentes delimitações em cada carcaça, carcaça inteira, cortes comerciais e segmentação transversal, para cada uma foram calculados oito descritores de forma: área, perímetro, largura, comprimento, além de  convexidade, solidicidade, proporção e circularidade,para as delimitações da segmentação transversal, ainda foram obtidas razões entre áreas, larguras e comprimentos de cada par. Com base nas diferentes delimitações determinadas na carcaça, foram estabelecidos quatro conjuntos de dados, denominados descriptors sets (DSs), aos quais foi adicionada a informação PCF como variável preditora, gerando mais quatro DSs’.O banco formado a partir dos DSs foi randomicamente dividido em treinamento e teste, sendo o banco de treinamento combinado a técnica k-foldcross-validation, a fim de possibilitar o processamento na técnica stepwise uma redução por PLS-R foi realizada. Para a avaliação da performance dos modelos, utilizou-se as métricas RMSE, R2 e BIAS, que foram ranqueadas no intuito de se determinar mais precisamente qual o melhor modelo, dos 552 modelos preditivos formados, de modo geral a presença do PCF, melhorou os ajustes em todas as técnicas, ainda assim o Stepwise apresentou os piores ajustes para todas as variáveis testadas, LASSO e elastic net mantiveram comportamento semelhante, contudo com base no critério de parcimônia o LASSO formou modelos mais simplificados e com bons ajustes, dos descritores testados houve prevalecia para os mais simples com área, perímetro, largura, comprimento, a convexidade mais representativa para os modelos voltados para características de musculo e gordura, circularidade nos modelos DS1 e DS1’ e DS3’. Para as variáveis testadas neste estudo, os descritores de forma propostos, foram eficientes em sua maioria na predição de variáveis teciduais e de peso, dos DSs testados LASSO DS1’ apresentou melhores ajustes para variáveis como músculo total, gordura total seguido de cortes como, paleta, lombo, costela, LASSO DS3 foi melhor na predição de variáveis de gordura, total, do pernil, paleta e peso da costela LASSO DS4’. Os descritores obtidos a partir do processamento de imagens são eficientes na predição de características teciduais de cordeiros deslanados e a técnica que apresentou melhor ajustes para este estudo foi o LASSO.

  • ALINNE ANDRADE PEREIRA
  • Terminação de Cordeiros Santa Inês e Mestiços em Confinamento: Desempenho, Característica da Carcaça e Componente Não Carcaça

  • Data: 26/02/2019
  • Mostrar Resumo
  • Objetivou-se com este trabalho avaliar o efeito dos genótipos de cordeiros Santa Inês e mestiços Dorper x Santa Inês, submetidos a diferentes estratégias de entrada e saída do sistema de confinamento, através do desempenho, característica da carcaça e componente não carcaça. Utilizou-se setenta e dois cordeiros, machos, castrados, 36 Santa Inês (SI) e 36 mestiços (Dorper x Santa Inês – DSI), com idade inicial média deseis meses.Efetuou-se a formação dos grupos experimentais estabelecidos com delineamento experimental inteiramente casualizado em arranjo fatorial 2 x 3 x 4, a partir da combinação dos grupamentos genético (GG), peso corporal ao início do confinamento (PIC) e tempos de permanência no confinamento (TPC). Foram formadas três classes de peso corporal ao início do confinamento: Leve (25 ±1,57 e 25 ±2,40 kg), Intermediária (28 ±1,72 e 28 ±1,40 kg) e Pesada (31 ±1,01 e 31 ±1,54 kg), para Santa Inês e mestiços, respectivamente. Os abates foram realizados a cada 28 dias, em quatros TPC: 0, 28, 56 e 84 dias. As análises estatísticas foram realizadas no pacote caret do softwareR version 3.5.1 (R Core Team, 2018).Verificou-se que o GG não influenciou (p>0,05) nenhuma das características de desempenho, carcaça e componente não carcaça dos cordeiros. Nos PIC houve efeito significativo (p>0,05) com maiores pesos na classe pesada, para as variáveis de peso inicial e final, peso metabólico, peso corporal ao abate, peso do corpo vazio, peso de carcaça quente, peso de carcaça fria, peso do corte do lombo, peso do corte da paleta, peso da musculatura do pernil e peso da musculatura e gordura do lombo. Para os TPC houve efeito significativo (p>0,05) com maiores aos 84 dias, para as variáveis peso final, peso metabólico, peso corporal ao abate, peso do corpo vazio, peso de carcaça quente, rendimento de carcaça quente, peso de carcaça fria, rendimento de carcaça fria, área de olho de lombo, espessura de gordura subcutânea, peso dos cortes, para os componentes da relação tecidual dos cortes e para as gorduras perirrenal, pélvica e inguinal. Houve efeito da interação (p>0,05) para o ganho de peso médio diário, relação tecidual musculo/gordura: osso e para o omaso cheio e vazio, reticulo/rúmen vazio e gordura perirrenal. Conclui-se que os ovinos mestiço Dorper x Santa Inês obterão característica semelhantes aos raça Santa Inês para desempenho, carcaça e componente não carcaça, indicando ausência do efeito da heterose.Uma boa alternativa seria confinar os ovinos com 31 kg para alcançar maior rentabilidade e a escolha do melhor período ao abate depende da preferência do mercado consumidor.

  • NAUARA MOURA LAGE FILHO
  • AVALIAÇÃO DO CAPIM-TANZÂNIA SUBMETIDO A INTENSIDADES DE CORTE EM REIGÃO DE CLIMA TROPICAL ÚMIDO

  • Data: 26/02/2019
  • Mostrar Resumo
  • Objetivou-se com o presente trabalho, determinar o efeito de intensidades de desfolhação sobre as características morfogênicas, estruturais e produtivas de Panicum maximum cv. Tanzânia durante as estações climáticas seca de 2017 e chuvosa de 2018, em região de clima tropical Am. O delineamento experimental utilizado foi em blocos casualizados, com cinco tratamentos correspondentes a intensidade de desfolhação, baseada no resíduo mantido na área 15; 25; 35; 45 e 55 cm, com seis repetições, sendo a unidade experimental correspondendo parcelas de 12 m2 a campo. Foram avaliados o tempo de rebrota do capim, as características morfogênicas, taxa de aparecimento de foliar (TApF), filocrono (Filo), taxa de alongamento foliar (TAlF), taxa de senescência foliar (TSeF), duração de vida da folha (DVF) e taxa de alongamento de colmo (TAlC), as características estruturais do dossel, tamanho final de folha (TFF), número de folhas vivas (NFV), densidade populacional de perfilhos (DPP), altura, índice de área foliar (IAF), taxa de aparecimento de perfilhos (TAP), taxa de mortalidade de perfilhos (TMP) e taxa de sobrevivência de perfilhos (TSP), e características produtivas, acúmulo de MS total, produção de lamina foliar, colmo e material morto. A média das variáveis dos tratamentos dentro de cada estação climática foi submetida a análise de variância e o desdobramento da interação entre as intensidades e a estação climática foram efetuados quando significativos pelo teste F com significância de 5%. As médias foram analisadas por contrastes polinomiais ortogonais utilizando o procedimento PROC MIXES do software SAS. Foi observado interação entre a intensidade de desfolhação x estação climática (p<0,05) para as variáveis Filo, TSeF, DVF, TFF, NFV, altura, TMP, acúmulo de matéria seca total, produção de lâmina foliar e produção de material morto. As variáveis DPP e IAF foram afetadas apenas pela intensidade de desfolhação (p<0,05), enquanto na TAlF foi observado apenas efeito entre estações climáticas (p<0,05).  Já as variáveis TApF, TAP, TSP e produção diária de forragem, tiveram efeito tanto da intensidade de desfolhação, quanto da estação climática (p<0,05). A intensidade de desfolhação altera as características morfogênicas e estruturais do capim-Tanzânia.

  • GEILSON SILVA TENÓRIO
  • PESCA, BIOLOGIA E ESTRUTURA POPULACIONAL DO AVIÚ Acetes paraguayensis Hansen, 1919(CRUSTACEA: DECAPODA: SERGESTIDAE) NO RIO TAPAJÓS, PARÁ, BRASIL

     

     

  • Data: 22/02/2019
  • Mostrar Resumo
  • Acetes paraguayensisHansen, 1919, constitui-se em uma espécie de grande importância ecológica, social e econômica para a população onde ocorre, inclusive concorrendo como uma espécie com enorme potencial aquícola, porém é muito pouco estudada. Visando contribuir para o maior conhecimento e melhor aproveitamento deste recurso, foram realizadas coletas mensais, em 06 estações de pesca, tanto de organismos pertencentes a esta espécie quanto das variáveis abióticas. Ao total foram realizados cento e cinquenta e seis amostras abióticas (26 meses x 06 matapis por mês), com auxílio de uma pequena embarcação de madeira alugada, e cento e vinte coletas bióticas (20 meses x 06 matapis por mês). Ambas as amostragens foram efetuadas, nas mesmas estações de pesca no rio Tapajós, durante o período diurno, em Santarém-PA, entre maio de 2016 a junho de 2018, englobando o período chuvoso e menos chuvoso. As amostragens biológicas foram obtidas ao acompanhar os pescadores nas despescas dos matapis, do tipo duplo, com dimensões semelhantes (covo - 2, 50 m de comprimento x 1, 50 m largura x 2, 50 m de altura, abertura de 0, 03 m e esteira - 20, 0 m de comprimento x 3, 0 m de altura), distantes a mais de 200, 0 m entre si. O material obtido da despesca dos matapis foi acondicionado em sacos plásticos, etiquetado conforme a estação de pesca amostrada e depositado em caixas térmicas com gelo. Posteriormente, esse material foi transportado para o laboratório da Estação Santa Rosa, onde foi realizada as análises pertinentes. Em razão do completo desconhecimento de diversos aspectos relacionados a A.paraguayensis, esta tese está composta por quatro capítulos, no intuito de tentar disponibilizar aos interessados, o máximo das informações coletadas durante todo o período da pesquisa acerca da espécie. Principalmente as relacionadas à sua pesca e apetrechos utilizados em sua captura, estrutura populacional, aspectos da sua biologia e suas inter-relações com variáveis ambientais amostradas. No Capítulo I, há uma introdução geral, onde se aborda vários aspectos dos camarões do gênero Acetes, tais como morfologia, classificação, chaves de identificação sexual, distribuição geográfica, dispersão entre habitats, proporção sexual, relações biométricas e morfométricas, entre outros, bem como a pesca e sua destacada importância econômica no mundo e na Amazônia, especificamente. No Capítulo II, foram identificados 66 novos pontos de captura, constatando que a área onde se pratica atualmente a pesca de Aparaguayensisé extensa, não se restringindo apenas aos locais próximos de Santarém, conforme as informações esparsas, desencontradas e imprecisas disponíveis na literatura até o presente momento. Os períodos de maior volume de captura da espécie são os meses chuvosos, quando ocorre o período de aglomeração dos animais, destacando-se entre eles, por ordem crescente em volume de produção, março, abril e maio, respectivamente. Os apetrechos identificados e mais utilizados na captura da espécie na área de estudo são seis: arrasto com panagem de poliéster; rede arrasto de poliéster; puçá-de-mão, puçá-de-mão; puçá arrasto-de-popa, e finalmente, o matapi. Todas as artes pesquisadas utilizam o método de pesca ativo, exceto o matapi. Dentre os apetrechos, o matapi se destaca por ser o mais oneroso (US$ 345.81), empregar maior número de pescadores, e o mais produtivo, com maior quantidade de dias de pesca efetiva (10.57 ± 13.71) que os demais. Porém, também é o que causa maior dano ambiental, já que captura uma grande quantidade de peixes pequenos (fauna acompanhante), muitos dos quais, de valor comercial. No Capítulo III, foi comprovado a efetividade dos matapis na captura de Aparaguayensis, embora utilize o método passivo de captura, diferentemente de outras artes utilizadas ao redor do mundo na pesca de sergestídeos. Verificou-se que os apetrechos que utilizaram lâmpadas como atratores luminosos, apresentaram maior produção mensal e CPUE em relação aos que não as empregaram, demonstrando que esta estratégia interfere positivamente nas capturas de A. paraguayensisna área estudada (fototropismo positivo).Observou-se também, uma forte correlação entre a pluviosidade, o pulso de inundação e a produção de A. paraguayensisprovenientes dos matapis, sendo os maiores valores de captura registrados nos meses mais chuvosos. No Capítulo IV, foram pesquisadas a estrutura populacional, proporção sexual e as relações bio-morfométricas de Aparaguayensis.Foram analisados 3690 indivíduos (fêmeas = 2325 e machos =1365), sendo os machos mais abundantes nas menores classes de tamanho, e as fêmeas, dominantes em classes maiores. As fêmeas apresentaram comprimento total médio (LT= 21,44 ± 2,39 mm) e de carapaça (LC=5,13 ± 0,68 mm) maiores que os machos (LT=19,19 ± 2,11 mm) e (LC=4,50 ± 0,58 mm), respectivamente. Já a proporção sexual foi de 1, 7♀: 1♂. No que concerne às relações entre o peso e comprimento total, os machos e sexos agrupados (machos mais fêmeas) apresentaram crescimento alométrico negativo (b<3), enquanto que as fêmeas, crescimento isométrico (b=3). Para as relações entre comprimento total (mm) e comprimento da carapaça (mm), todos os grupos (machos, fêmeas e sexos agrupados) apresentaram crescimento alométrico positivo (b>1). Durante todo o período de coletas, as fêmeas foram mais abundantes e apresentaram os maiores valores em comprimento (total e de carapaça) e peso, quando comparadas aos machos, reforçando a hipótese da existência de dimorfismo sexual em comprimento. Neste estudo, foi observado que a espécie Aparaguayensisforma grandes aglomerados paralelos à linha costeira, nadando acompanhando o fluxo das correntes fluviais, e também na foz dos rios e das conexões entre os grandes rios e os lagos. A pesca de A. paraguayensiscoincide com a época de aglomeração, que corresponde ao período chuvoso na Amazônia (dezembro a maio). Neste período, observa-se um aumento da biomassa planctônica, o qual está associado ao período reprodutivo desta espécie. Constatou-se também que A. paraguayensisé fortemente sazonal e migradora, reduzindo drasticamente sua abundância entre os meses de junho (início do período de seca) e agosto, não ocorrendo na área de estudo nos meses de setembro, outubro e novembro, voltando a surgir apenas esporadicamente, no mês de dezembro, em pequenas quantidades, quando tem início o período das enchentes.Durante o período inicial da estiagem (de seca), os animais realizam uma migração para os grandes lagos para desovar, possivelmente em razão da maior disponibilidade de alimentos, existente nesses locais e a proteção contra possíveis predadores. Os resultados obtidos no presente trabalho são inéditos, e demonstram que essa espécie, apesar da elevada relevância ecológica, econômica e social, nunca tinha sido antes pesquisada, em razão da ausência de dados disponíveis, provavelmente por causa das dificuldades de obtê-los em campo, e da escassez de pesquisadores interessados. Essas informações são de grande valia para trabalhos futuros que visem o manejo populacional, a preservação e o cultivo dessa espécie, que vem sendo intensamente explorada na região em estudo.

     

     

     

     

     

     

  • FRANCISCO ALEX LIMA BARROS
  • Composição e mudanças espaciais e temporais da diversidade e da densidade do mesozooplâncton em um estuário amazônico (Emboraí, Pará/Brasil).

  • Data: 21/02/2019
  • Mostrar Resumo
  • O presente estudo investigou o efeito das mudanças na precipitação sobre os componentes hidrológicos e os possíveis impactos dos mesmos sobre a diversidade e densidade da comunidade mesozooplanctônica do estuário do Emboraí Velho, Norte do Brasil. As coletas foram realizadas durante marés de sizígia, em duas estações fixas localizadas ao longo do estuário (estação superior-E1 e médio-E2). As campanhas de campo ocorreram nos meses de janeiro e abril (período chuvoso), e agosto e novembro (período seco) de 2018. As amostras do zooplâncton foram obtidas utilizando-se redes cônicas de plâncton com aberturas de malha de 200 μm (equipadas com fluxômetros mecânicos), ao longo de um período de 25 h, em intervalos regulares de 3 horas, resultando em um total de 72 amostras.Simultaneamente, as medidas de salinidade e temperatura foram determinadas através de CTDO’s, sendo os registros realizados a cada 10 minutos. Adicionalmente, foram coletadas amostras subsuperficiais de água, através de garrafas de Niskin, para determinação do pH, da turbidez, e das concentrações de clorofila-a e oxigênio dissolvido-OD. O aumento do regime pluviométrico, característico dos primeiros meses do ano na região Amazônica, foi responsável por oscilações nas variáveis ambientais. A salinidade aumentou significativamente de 21,77±7,83, no período chuvoso, a 25,87±7,40, no período seco (F= 5,21; p> 0,05). Não foi evidenciado um padrão de variação sazonal para turbidez, e para as concentrações de clorofila-a e OD.Um total de 26 espécies foram identificadas, com destaque para os copépodos Acartia lilljeborgi (2.708± 4.955 ind.m-3), Pseudodiaptomus marshi (130±230 ind.m-3), P. richardi (429±713 ind.m-3), Paracalanus quasimodo, (559±828 ind.m-3), Euterpina acuntifrons(339±677 ind.m-3), Oithona hebes(247±327 ind.m-3)eO. oswaldocruzi (56±97 ind.m-3), e para os Appendicularia O. dioica (745±1.280 ind.m-3), as quais constituíram as espécies dominantes no ambiente em estudo. A partir dos resultados obtidos foi possível evidenciar que a alternância da dominância das espécies identificadas esteve determinada por suas tolerâncias às variações de salinidade e pelas taxas de recrutamento, estando a composição e densidade do mesozooplâncton do estuário do Emboraí fortemnte influenciadas pela variação sazonal dos fatores físicos e químicos da água, como observado previamente em outros estuários da região.

     

  • CAROLINA SARMANHO FREITAS
  • RELAÇÕES ENTRE ATRIBUTOS DE FORMA, COLORAÇÃO E TEXTURA DA IMAGEM DA CARCAÇA, CARACTERÍSTICAS TECIDUAIS DA CARCAÇA E QUALIDADE DA CARNE DE CORDEIROS DESLANADOS

  • Data: 20/02/2019
  • Mostrar Resumo
  • Objetivou-se com este trabalho, avaliar se as medidas de Video Image Analisys, utilizando imagens de carcaças de cordeiros resfriadas, fornecem uma descrição consistente sobre as características extraídas da carcaça e carne. Os procedimentos experimentais foram aprovados pelo comitê de ética em pesquisa e experimentos animais (CEPAE protocol number 97-2015). As informações utilizadas foram obtidas de 88 carcaças frias de cordeiros machos, mestiços (Dorper x Santa Inês), terminados em confinamento. Os animais apresentaram peso corporal ao abate entre 21 e 49 kg. Após 24 horas de abate e refrigeração a 4 ºC, aferiu-se o peso de carcaça fria e rendimento de carcaça fria. As imagens das carcaças frias foram obtidas com a utilização de câmera digital com 16 MP de resolução (Nikon Power Shot SX160 IS®), posicionada a dois metros de distância da estrutura de suporte e 1,5 metro de altura, de modo a obter a imagem completa. As carcaças foram posicionadas longitudinalmente por meio das articulações tarso-metatarsianas e fotografadas nas vistas dorsal e lateral. O processamento das imagens foi realizado via software ImageJ 1.05i, utilizando GLCM (Gray Level Coocurrence Matrix), a fim de extrair as características de textura das áreas selecionadas, e o algoritmo Cluster K-Means, determinando-se a projeção da carcaça e três áreas de análise nas vistas dorsal e lateral: áreas posterior, mediana e anterior. Os valores da projeção e de cada área foram obtidos em pixel, para determinação de proporções estimadas de gordura e músculo expostos. Para validação do modelo teórico será utilizada a modelagem de equações estruturais (SEM), aplicando-se a técnica de PLS-PM (Parcial Last Square- Path Mode), a qual possibilita mensurar as inter-relações das variáveis, elaborando-se equações de predição para ambas. A VL que apresentou menor redução na vista lateral foi a IMAGEM que reduziu de 64 para 24 no banco de dados lateral transversal completa. CORTES teve uma redução de 8 variáveis manifestas, CARCAÇA foi a VL que apresentou menor redução, sendo excluídos apenas o peso do músculo e peso do osso. Já para QUALICARNE foram excluídas grande parte das variáveis referentes a coloração permanecendo apenas aquelas que tem relação com o espectro de luz amarela (b* e H0) que estão relacionados ao teor de amarelo presente na gordura que recobre a carne, além da força de cisalhamento e da cocção na vista lateral e dorsal da carcaça, permanecendo assim 4 das 9 variáveis manifestas que formavam a VL QUALICARNE, demonstrando assim que há relação entre as medidas de forma obtidas através de imagens com características da carcaça, cortes primários e com algumas características de cor, textura e cocção na qualidade da carne.

2018
Descrição
  • DANILLO HENRIQUE DA SILVA LIMA
  • Infecção experimental por Anaplasma marginale em búfalos e bovinos: esplenectomia, aspectos clínicos, hemato-bioquímicos, parasitológicos, patológicos e moleculares

  • Data: 21/12/2018
  • Mostrar Resumo
  • Os objetivos da presente pesquisa foram descrever uma técnica de esplenectomia e comparar os aspectos clínicos, hematológicos, bioquímicos, parasitológicos, patológicos e moleculares da anaplasmose em bubalinos e bovinos inoculados experimentalmente com estirpe AmRio 2 de A. marginale. No artigo um, foram utilizados quatro bubalinos Murrah e quatro bovinos mestiços. Dois animais de cada espécie foram esplenectomizados através do 12º espaço intercostal esquerdo e amostras de sangue foram colhidas em momentos pré e pós a cirurgia para realização de hemograma e bioquímica. A técnica utilizada apresentou boa aplicabilidade e foi considerada segura. Os bovinos esplenectomizados apresentaram maiores alterações no hemograma após a cirurgia. No artigo dois, os animais do estudo anterior foram infestados com um grama (1g) de larvas de Rhipicephalus (Boophilus) microplus e foram inoculados com estirpe AmRio 2 de A. marginale. No 21º dia após infestação, foi realizada a coleta dos carrapatos para detecção de cópias de DNA da riquétsia através de Semi-Nested PCR (snPCR) para os genes alvo msp5 e msp1α. Os bovinos apresentaram em média 87±33 carrapatos/animal, enquanto que, os bubalinos apresentaram em média 49±19 carrapatos/animal. Os carrapatos coletados foram positivos nas snPCR´s. No artigo três, os animais do estudo anterior foram utilizados para comparar os aspectos clínicos, hemato-bioquímicos, parasitológicos, patológicos e moleculares após infecção de estirpe AmRio 2 de A. marginale. Foram realizados exames clínicos, hemograma, hematócrito, avaliação de riquetsemia, necropsia e histopatologia, snPCR para os genes alvos msp5 e msp1α de A. marginale nas amostras de sangue dos animais, além de, sequenciamento do gene msp1α. Apenas dois bovinos esplenectomizados apresentaram anaplasmose. O período de incubação nestes animais foi de 25,5 dias e os mesmos morreram em média 63 dias após inoculação da estirpe. Os achados de necropsia caracterizaram-se por carcaça pálida, vesícula biliar repleta e distendida. À histopatologia, verificou-se infiltração de macrófagos e linfócitos em diversos órgãos. À snPCR para os genes msp5 e msp1α foi positiva em todos os animais. Entretanto, o sequenciamento revelou cinco animais com sequências de aminoácidos da estirpe AmRio 2. Os bovinos esplenectomizados morreram em virtude de anaplasmose provocada pela estirpe inoculada e os bubalinos não apresentaram alterações clínicas.

  • HENRIQUE DOS ANJOS BOMJARDIM
  • Aspectos epidemiológicos, clinico-patológicos, moleculares e tratamento tópico com óleo de copaíba da dermatite digital bovina no bioma amazônico brasileiro

  • Data: 20/12/2018
  • Mostrar Resumo
  • Este estudo teve por objetivo descrever os aspectos epidemiológicos, clínico-patológicos e relatar a ocorrência de Treponema spp. nas lesões de dermatite digital bovina (DDB) em vacas mestiças leiteiras criadas a pasto no bioma amazônico brasileiro. Assim como, testar o tratamento tópico com o óleo de Copaifera reticulata. Para tanto, realizou-se a inspeção das extremidades distais das vacas em lactação, durante a ordenha, em uma a quatro visitas a 15 propriedades no período de agosto de 2016 a julho de 2017. A prevalência de DDB em 10 propriedades foi de 1,3% (22/1.664) e não se obteve diferença estatística entre os períodos chuvoso e não chuvoso (P > 0,05). As lesões observadas caracterizaram-se por ulceração (estágios M1 e M2), com superfície coberta por material crostoso ou hiperqueratótico (M3 e M4) e em estágio M4 com área de ulceração (M4.1). Pelos hipertrofiados nos bordos das lesões, larvas de moscas do gênero Cochliomyia spp. e alterações no tecido córneo também foram observados. Na histologia das lesões foram observados focos de ulceração com colônias bacterianas e infiltrados polimorfonucleares, na epiderme e na derme. Hiperqueratose paraqueratótica foi observada de forma acentuada nos estágios M3, M4 e M4.1. Em 24 biópsias, obtidas de 24 bovinos de 15 propriedades, em diferentes estágios das lesões de DDB, foram observadas espiroquetas em 54,2% (13/24) das lesões (método de Warthin-Starry) e em 91,7% (22/24) detectou-se o DNA de pelo menos um dos filogrupos de treponemas pesquisados pela Nested-Reação em Cadeia de Polimerase. T. putidum/T. denticola-like foi o filogrupo mais detectado em todos os estágios e os filogrupos Treponema medium/T. vincentii-like e T. phagedenis-like apresentaram uma maior proporção nas lesões ativas (M2 e M4.1), mas não se obteve diferença estatística na ocorrência dos filogrupos entre os estágios das lesões (P > 0,05). O tratamento com o óleo de copaíba apresentou um índice de cura de 83,4% (5/6) e assemelhou-se com o ácido salicílico (tratamento controle), que foi de 75% (3/4). Ambos os tratamentos apresentaram um período médio de 7 semanas da retirada da bandagem até a recuperação do tecido normal. Conclui-se neste trabalho que a DDB no bioma amazônico é uma doença politreponemal com características macro e microscópicas semelhantes às lesões de vacas leiteiras criadas em estábulos, ocorre em baixa prevalência e não é sazonal. O óleo da copaíba pode ser utilizado como auxílio a medidas de controle da DDB no bioma amazônico.

  • LUCIANA DA SILVA SIQUEIRA
  • ESTUDO ANATOMOTOPOGRÁFICO E RADIOGRÁFICO DE ESÔFAGO EM PREGUIÇA Bradypus variegatus: APLICADA AO ATENDIMENTO CLINICO CIRÚRGICO

  • Orientador : SHEYLA FARHAYLDES SOUZA DOMINGUES
  • Data: 20/08/2018
  • Mostrar Resumo
  • A preguiça-comum (Bradypus variegatus) é encontrada em remanescentes florestais urbanos, em razão do crescimento desordenado das atividades antrópicas. O que tem movido a destruição das áreas de ocorrência natural da espécie. Assim, cada vez mais são encontradas vítimas de traumas em áreas urbanas. Podendo apresentar lesões na região craniofacial, ocasionando na limitação de alimentar-se de forma voluntaria. Sendo indicado suporte nutricional enteral nesses animais que necessitam de alimentação prolongada. Dessa maneira, o presente estudo tem como propósito consolidar base cirúrgica, visando o aprimoramento da técnica de esofagostomia cervical direcionada a essa espécie, empregando-se cateter vesical de demora (Foley, 2 vias, látex siliconizado, numeração 08 a 16 Fr/Ch), como sonda esofágica. Foi utilizado 11 exemplares anatômicos glicerinados de preguiça-comum, sendo 08 filhotes e 03 adultos, do acervo anatômico do Hospital Veterinário da Universidade Federal do Pará (HSAS/UFPA), obtidas no período de 2013 a 2017. Dos quais, cinco peças (quatro filhotes e um adulto), foram desempenhada radiografia contrastada com Sulfato de Bário a 100%, usando volume de 1 a 2 ml (filhote) e 4 ml (adulto), nas projeções ortogonais (laterolateral esquerda e ventrodorsal), usando aparelho radiográfico X-House/Orion. Onde notou-se que o traçado esofágico não pode ser determinado com precisão na posição ventrodorsal, em virtude da dificuldade de posicionar as peças anatômicas durante o exame. Ao passo que, na posição laterolateral esquerda, o esôfago estendeu-se do 9ª ao 11ª espaço intercostal para os filhotes e 8ª para um espécime adulto. Posteriormente, cercou-se do estudo morfométrico e anatomotopografica do esôfago cervical nas peças. O qual, o esôfago cervical apresentou média de 2,58/0,25 cm (filhote) e 6,6/ 0,43 cm (adulto), localizando inicialmente dorsal a cartilagem cricóidea da laringe e acompanha pela esquerda a traqueia ao longo da região cervical até adentrar a cavidade torácica, estabelecendo sintopia com a artéria carótida comum esquerda e veia jugular externa. A lateralidade esquerda do esôfago ocorre a partir do 4° e 7° anel traqueal. Em sequência, instituiu esofagostomia cervical convencional praticado em preguiça-comum conforme abordado em animais domésticos e a esofagostomia cervical empregada em tamanduá-bandeira (Myrmecophaga tridactyla) que foi adaptada para Bradypus variegatus, consistiu abordar o terço final da região cervical na linha paramediana, a esquerda da linha média, usando sondas de Foley. Constatou-se que a esofagostomia cervical convencional não foi praticável em comparação a abordada em tamanduá-bandeira e averiguou-se que as sondas de Foley nenhuma foi exequível em filhotes, devido ao diâmetro e a presença do balão de retenção na extremidade dessa sonda, mas em adultos, essas sondas de númeração 8, 10, 12 e 14 Fr/Ch foi praticável. Portanto, o conhecimento anatômico, topográfico e radiográfico do esôfago cervical em preguiça-comum, bem como a técnica e o material utilizado nesses animais, torna-se importante para estabelecer para o atendimento clinico cirúrgico em Bradypus variegatus

  • ALESSANDRO GIRO
  • Monitoramento de temperatura corpórea e comportamento diurno de fêmeas bovinas de corte (Bos taurus x Bos indicus) em sistemas integrados de produção

  • Data: 02/08/2018
  • Mostrar Resumo
  • O presente estudo teve como objetivo ampliar os conhecimentos sobre a aplicação de técnicas de monitoramento da temperatura interna corpórea e sobre o conforto térmico de bovinos de corte mantidos em sistema de integração lavoura-pecuária-floresta (iLPF). Foram realizados dois experimentos, sendo usadas fêmeas bovinas adultas da raça Canchim (⅝Charolês x ⅜Zebu). No primeiro experimento, avaliou-se o uso de dispositivo eletrônico tipo transponder e da termografia de infravermelho para inferência da temperatura interna corpórea de animais a pasto (n=23). Foram realizados 11 períodos de coleta, com intervalo médio de 12 dias, para inferência da temperatura de núcleo corpóreo, sendo esta última mensurada por termometria clínica e adotada como referência. O uso do microchip subcutâneo representou ser prático, mas ainda com limitada capacidade, enquanto a termografia de infravermelho foi o método mais seguro e não-invasivo para a inferência da temperatura interna corpórea. No segundo experimento, os animais foram mantidos a pasto em dois sistemas de produção: integração lavoura-pecuária (iLP, n=11) e iLPF, com área arborizada (n=12). Os dados climáticos foram coletados por duas estações meteorológicas, em ambos sistemas. O comportamento dos animais foi registrado mensalmente, sendo observado o tempo despendido em atividade (pastejo, ruminação e ócio), postura adotada (em pé ou deitado), e a localização dos animais no tratamento iLPF (ao sol ou sob sombra), além da frequência de ingestão de água e de sal mineral. A aferição da temperatura de superfície corpórea foi realizada a campo, com termografia de infravermelho. Os dados foram analisados por turno (manhã e tarde), dentro de cada mês (janeiro a junho). O sistema iLPF amenizou as condições do microclima das pastagens e demonstrou ser favorável ao conforto térmico. Os animais de ambos os tratamentos, quando expostos a situações de desafio térmico, não apresentaram alterações no tempo de suas atividades. Em pastagens com componente arbóreo, bovinos de corte apresentaram preferência pela utilização da sombra, menor ingestão de água e menor temperatura de superfície corpórea.

  • DÁRIO LISBOA FERNANDES NETO
  • Manejo da postura em muçuã Kinosternon scorpioides (Linnaeus, 1766) submetidos a diferentes níveis de cálcio na dieta.

  • Data: 30/05/2018
  • Mostrar Resumo
  • O maior conhecimento das exigências alimentares, quanto aos minerais, podem servir de base para formulações em dietas de quelônios, como alternativas para corrigir deficiências destes compostos nas rações fornecidas em cativeiro. Este trabalho objetivou avaliar a influência do cálcio na qualidade do ovo e no desempenho produtivo de fêmeas Kinosternon scorpioides na fase de reprodutiva. O experimento foi conduzido no Campus Experimental Ermerson Salimos – Embrapa Amazônia Oriental. Foram utilizados 165 animais,150 fêmeas e 15 machos, distribuídos num delineamento inteiramente casualizado em 15 unidades experimentais, na relação de 10:1. Os animais foram submetidos a cinco tratamentos com dietas isonutritivas variando apenas os níveis de cálcio (1.7, 2.7, 3.7, 4.7 e 5.7% Ca) em três repetições. Os resultados mostraram que houveram diferenças significativas (p<0,05) no peso da carapaça mais plastrão, rendimento de carcaça e peso dos rins. O maior peso do casco foi observado nas fêmeas que receberam dietas com o maior nível de cálcio (T5), não se diferenciando também nos tratamentos T1, T3 e T4. O maior rendimento de carcaça foi observado nos tratamentos com 3,7% e 4,7% de Ca. O menor rendimento de carcaça foi encontrado no tratamento T2, por ter apresentado o menor peso de carapaça mais plastrão (P<0,05), este também apresentou o maior peso dos rins (p<0,05). Os menores pesos de rins foram registrados nos tratamentos 4,7 e 5,7% Ca. Não houve diferenças significativas no peso vivo, peso da carcaça sem a carapaça, peso do coração, peso do fígado e peso dos ovários (p>0,05). Houve diferença significativa (p<0,05) na produção de ovos, na taxa de postura, no número de ninhos e na conversão alimentar por ovo. Os melhores resultados foram encontrados no tratamento T3 e T4, ou seja, quando as dietas continham entre 3,7% e 4,7% Ca. Níveis de cálcio acima desses valores, com nível de 5,7% Ca não se diferenciam estatisticamente, porém causaram a diminuição em todos os demais parâmetros. Ração com níveis abaixo de 3,7% Ca causaram diminuição significativa na produção de ovos, taxa de postura e quantidade de ninhos. Não houve influências significativas (p>0,05) dos diferentes níveis de cálcio na quantidade na profundidade e ovos por ninho. Houve diferença significativa (p<0,05) no peso dos ovos e na massa de ovos. Os ovos de maior peso foram ovipostos por fêmeas submetidas a 4,7% de cálcio (T4) na dieta. A massa de ovos, o produto entre a produção de ovos e o seu peso, apresentaram melhores resultados nos níveis de 3,7% e 4,7% Ca. Nível baixo de cálcio (1,7% Ca) na dieta de fêmeas em postura causam significativas perdas de peso no ovo. O cálcio na dieta das fêmeas não influenciou (p>0,05) no comprimento e na largura dos ovos. O ciclo de postura foi maior quando a dieta continha 3,7% Ca (T3). Níveis acima de 5,7% ou abaixo até 2,7% Ca diminuíram o ciclo de postura, mas sem significância (P>0,05). No entanto, o nível baixo de cálcio (1,7% Ca) causa diminuição significativa no tamanho do ciclo de postura. O maior consumo de ração foi no tratamento T3, no entanto, este apresentou a maior massa de ovo, e melhor conversão alimentar por ovo, junto ao tratamento T4. Por outro lado, o menor consumo de ração foi registrado nos animais que receberam a dieta com menor nível de cálcio (1,7% Ca), com isso, esses animais ingeriram a menor quantidade de cálcio dentre todos os tratamentos (p<0,05). A maior ingestão de cálcio foi observada no tratamento T5 (5,7% Ca), demonstrando que esse mineral não limita o consumo da ração, visto que, esses animais não diferiram no consumo de ração durante a postura do tratamento de maior consumo (T3). A pior conversão alimentar por ovo foi encontrada no tratamento T2. Nos tratamentos com o maior nível de cálcio (5,7%) a conversão por ovo diminuiu, mas não teve efeito significativo quando comparado com o tratamento de pior conversão (2,7%).  O período de postura teve duração de cinco meses, com início em maio e término em setembro, e foram ovipostos 1058 ovos. O pico de postura ocorreu nos meses de junho e julho com 57,08% de ovoposições. No total, 297 ninhos foram registrados. A maior quantidade de ninhos acompanhou a produção de ovos, ocorrendo também nos meses de junho e julho (63,29%). Não houve diferença significativa na média de ovos por ninho, que foi de 3,455±0,375, a maioria dos ninhos continha entre 3 a 4 ovos (54,20%). Os menores níveis de cálcio e o maior (1,7%, 2,7% e 5,7% Ca) na dieta das fêmeas elevaram a quantidade de ninhos com apenas 1 ovo.  O maior consumo de ração em todos os tratamentos ocorreu no mês de julho, mês de pico de postura. O consumo de ração diferenciou-se significativamente (p<0,05) entre as fêmeas que receberam os variados níveis de cálcio. A média do consumo de ração por fêmea durante o ciclo de postura foi de 1,66g/animal/dia. A largura dos ovos sofreu influência (p<0,05) ao variar os níveis de cálcio na dieta das fêmeas. O tratamento que obteve melhor resultado sobre o parâmetro avaliado foi o que continha 3,7% (p<0,05) de Ca na dieta e o aumento dos níveis de cálcio acima desse valor, como em T4 e T5, não prejudicam a largura dos ovos. No entanto, dietas contendo valores baixos de cálcio na dieta (1,7% e 2,7% Ca), causam significativa diminuição da largura dos ovos. A menor largura dos ovos foi observada no tratamento T2 seguido do T1. Não houve influência do cálcio na força de cisalhamento, nem tanto nas medidas de largura e espessura do musculo dorsal do pescoço. Não houve influência do cálcio na força de cisalhamento, nem nas medidas de largura e espessura do musculo dorsal do pescoço. Os níveis de cálcio total e fosforo total responderam (P<0,05) aos teores de cálcio na dieta das fêmeas. As maiores concentrações desses elementos foram encontradas no sangue de fêmeas alimentadas com 3,7% Ca. O maior (5,7% Ca) e o menor (1,7% Ca) nível de cálcio nível na dieta causaram uma diminuição significativa nos níveis séricos de cálcio total. Sendo que os níveis de cálcio na dieta acima de 3,7% Ca causaram uma queda no fósforo total do sangue. A quantidade de proteína albumina, cálcio ionizado, sódio e potássio não sofreram significativas influências dos tratamentos nutricionais.

  • PATRÍCIA DA CUNHA SOUSA
  • ESTUDO DO PERFIL PROTEICO E DESCRIÇÃO ULTRAESTRUTURAL DO COÁGULO SEMINAL DE MACACOS-DE-CHEIRO (Saimiri collinsi Osgood, 1916)

  • Data: 25/05/2018
  • Mostrar Resumo
  • O sêmen de S. collinsi forma um coágulo de difícil manipulação, constituindo um fator limitante por impossibilitar a recuperação dos espermatozoides antes da dissolução dessa estrutura. Tal fenômeno tende a limitar a prática de biotecnologias da reprodução, tais como a criopreservação, a inseminação artificial (dentre outras), que requerem obtenção de gametas viáveis. O gênero Saimiri também apresenta uma característica marcante que é a presença de sazonalidade reprodutiva, a mais bem determinada entre primatas neotropicais, precedida por um peculiar aumento de tamanho/peso corporal dos machos (fenômeno fatted), ainda com razões pouco esclarecidas. Desse modo, é possível que o sêmen desses animais apresente particularidades quanto aos componentes biológicos, tais como as proteínas, durante o período reprodutivo; porém até o presente momento não existem relatos que demonstrem uma correlação entre esses componentes proteicos e a qualidade seminal acerca da sazonalidade reprodutiva de machos desse gênero. Assim, os objetivos desse projeto são determinar por eletroforese unidimensional e espectrometria de massa os componentes proteicos do coágulo seminal de S. collinsi, e avaliar potenciais associações entre essas proteínas e as características seminais de ejaculados colhidos durante e após o período sazonal de reprodução desta espécie. Este estudo também será complementado pela avaliação descritiva dos aspectos estruturais do coágulo seminal de S. collinsi, através de ultramicrografias de varredura e análise histológica.

  • DANIELA BOTTA
  • Características espermáticas do sêmen criopreservado bovino submetido a desafio térmico pelo calor


  • Data: 20/04/2018
  • Mostrar Resumo
  • O presente estudo teve o objetivo de avaliar como a temperatura de descongelação, a temperatura fisiológica e a temperatura de estresse térmico atuam sobre as características de cinética, de morfologia, de integridade de compartimentos celulares e sobre a capacidade de fecundação de espermatozoides criopreservados bovinos. Conhecendo a capacidade de resistência térmica dos espermatozoides criopreservados torna-se possível otimizar a sua utilização o que é de extrema importância considerando a menor disponibilidade de material genético de animais superiores e a menor fertilidade do sêmen criopreservado. O sêmen de cinco touros Canchim foi selecionado de um banco genético que compreendia 17 touros. Foram utilizadas quatro partidas de sêmen de cada touro que foram submetidas ao T36,0 (tratamento térmico à 36,0 °C), ao T38,0 (tratamento térmico à 38,0 °C) e ao T39,5 (tratamento térmico à 39,5 °C) pelo período máximo de quatro horas. O sêmen foi avaliado em momentos determinados, denominados de 0 h (momento imediatamente após a descongelação), 1 h (uma hora de incubação), 2 h (duas horas de incubação), 3 h (três horas de incubação) e 4 h (quatro horas de incubação) quanto às características de cinética, morfologia, integridade dos compartimentos espermáticos e capacidade fecundante. Todas as temperaturas estudadas foram capazes de causar prejuízos nas características de cinética, de integridade e funcionalidade dos compartimentos espermáticos e na fertilidade das células principalmente a partir da segunda hora de incubação. No entanto a temperatura de 39,5°C não é uma temperatura capaz de gerar uma maior quantidade de danos aos espermatozoides quando comparada com a temperatura fisiológica, o que não era esperado neste estudo. A motilidade total, progressiva e o padrão de movimentação celular são determinantes na produção de embriões in vitro.

  • ANDRÉA DO NASCIMENTO BARRETO
  • Efeito da energia na dieta sobre o desempenho e evolução das características reprodutivas de ovinos jovens Morada Nova


  • Data: 14/03/2018
  • Mostrar Resumo
  • O objetivo do trabalho foi estudar a o efeito do uso de alta energia na dieta de cordeiros da raça Morada Nova sobre o desenvolvimento corpóreo e a funcionalidade testicular, considerando características histomorfométricas e a qualidade seminal. Quarenta e dois machos recém-desmamados (90 dias, 16,0±1,0 kg) foram tratados com distintos níveis de energia: Grupo baixa energia (Low, n=21; 80% de volumoso+20% de concentrado; 2,05 Mcal/kg na dieta) e Grupo alta energia (High, n=21; 20% de volumoso+80% de concentrado; 2,37 Mcal/kg na dieta). Os animais foram mantidos em confinamento durante 23 semanas (S0 a S23). Peso e escore corporal diferiram significativamente a partir da S1 (p<0,05). De S5 em diante, perímetro torácico, comprimento corporal, altura de cernelha, altura, largura e comprimento de garupa foram maiores para High (p<0,05). A circunferência escrotal, o comprimento, largura testicular e volume testiculares foram maiores para High a partir da S3 (p<0,05). Apesar dos níveis de testosterona sérica não terem sido afetados (p>0,05) pelos tratamentos, o maior aporte energético incrementou o diâmetro dos túbulos seminíferos e do lúmen tubular, e promoveu maior desenvolvimento do epitélio epididimário (p<0,05). Isto influenciou positivamente a qualidade seminal, reduzindo os defeitos espermáticos menores (21,87 vs. 17,13%; p=0,02) e os defeitos totais (26,34 vs. 21,78%; p=0,01). Assim, é possível empregar maiores níveis de energia na dieta e fazer com que machos Morada Nova jovens expressem maior eficiência produtiva, associada a atributos reprodutivos de alto interesse. Isso pode contribuir para a valorização do genótipo e favorecer o uso deste recurso genético em sistemas de produção ovina.

  • KAYAN DA CUNHA ROSSY
  • AVALIAÇÃO HISTOLÓGICA EM BIÓPSIA OVARIANA VIDEOCIRÚRGICA COM PINÇA BIPOLAR EM OVINOS

  • Data: 06/03/2018
  • Mostrar Resumo
  • Este trabalho analisou tecidos oriundos de ovariectomia parcial, realizadas por 15 videolaparoscopia utilizando pinça bipolar, avaliando e mensurando dano no tecido em 16 ovinos. Seis ovelhas foram testadas, retirando metade do ovário com pinça bipolar por 17 videolaparoscopia por três portais. O corte foi feito no meio do ovário utilizando a pinça 18 bipolar, retirando o fragmento da cavidade. Os fragmentos foram submetidos aos 19 procedimentos histológicos padrões de corte seriado e montagem de lâminas, análise em 20 microscópio e com auxílio do programa “Image J”. Os resultados foram submetidos ao 21 teste estatístico ANOVA e pós teste de Tukay. Todas as lâminas analisadas 22 apresentaram dano mínimo ao tecido representando, em média, 1,8% do total biopsiado. 23 Com isso, esse estudo apresentou baixo percentual de dano no tecido, possibilitando que 24 o mesmo possa ser utilizado em técnicas reprodutivas futuras.

  • EZIQUIEL DE MORAIS
  • DESTILADO DA DESODORIZAÇÃO DO ÓLEO DE PALMA NA ALIMENTAÇÃO DE OVINOS: EFEITO NA DEGRADABILIDADE, DIGESTIBILIDADE E MICROBIOTA RUMINAL

  • Data: 02/03/2018
  • Mostrar Resumo
  • O óleo de palma (Elaeis guineensis, Jacq) é o óleo vegetal mais produzido no mundo com inúmeras aplicações na indústria, principalmente alimentícia. Durante seu processo de refino é gerado um resíduo denominado Destilado da Desodorização do Óleo de Palma (DDOP), o qual tem baixo valor de mercado, mas com características que possivelmente o tornam apto a alimentação animal. Diante disso o objetivo deste trabalho foi avaliar o efeito da inclusão DDOP na dieta de ovinos sobre a microbiota ruminal, degradabilidade in situ e digestibilidade aparente dos nutrientes. Foram utilizadas vinte ovelhas adultas distribuídas em cinco tratamentos que constituíram os níveis de 0, 25, 50, 75 e 100 g/kg de DDOP/kg de matéria seca (MS). As dietas foram formuladas para serem iso proteicas e iso fibrosas mantidas em uma relação volumoso:concentrado de 50:50, oferecidas na razão de 1,5% do peso vivo (consumo restrito). O nitrogênio amoniacal não foi afetado significativamente pelas inclusões do DDOP com média geral de 14,26 mg/ dL de liquido ruminal. O pH e tempo de redução do azul de metileno (RAM) foram aumentados nas dietas com maior nível de inclusão. A presença do DDOP reduziu (P<0,05) a população de protozoário nas dietas com mais de 25 g de inclusão, não diferindo (P>0,05) entre as dietas com maiores níveis. A degradação ruminal da MS, MO e frações fibrosas foram reduzidas quando 50 g/kg ou mais de DDOP foram inclusos a dieta. Os efeitos negativos sobre a degradação da fibra no rúmen refletiram sobre a digestibilidade da FDN e FDA, que da mesma forma para a MS e MO tiveram efeito linear negativo em suas digestibilidades, com redução de 0,95 e 0,91, e 0,66 e 0,67 pontos percentuais para cada 1% de inclusão, respectivamente. A Digstibilidade do extrato etéreo, no entanto, foi linear positiva, com aumento 1,16 pontos percentuais para cada unidade percentual de inclusão de DDOP. O DDOP não afeta os parâmetros de fermentação e degradação ruminal quando incluso em até 25 g/kg de MS, valores maiores comprometem a degradação ruminal e a digestibilidade da MS, MO e frações fibrosas.

  • VINÍCIUS COSTA GOMES DE CASTRO
  • DESEMPENHO PRODUTIVO E CARACTERÍSTICAS DE CARCAÇAS DE OVINOS RECEBENDO DIETAS COM COPRODUTOS DA AMAZÔNIA

  • Data: 01/03/2018
  • Mostrar Resumo
  • O objetivo do trabalho foi avaliar o efeito de dieta contendo coprodutos amazônicos sobre o consumo, digestibilidade, desempenho e característica quantitativa da carcaça de ovinos confinados. Foram utilizados vinte e quatro ovinos mestiços Santa Inês-Dorper, com peso médio inicial de 30±2 kg, distribuídos em delineamento inteiramente casualizado, com seis repetições e quatro tratamentos, representados por quatro dietas: controle e três contendo em sua composição, tortas de cupuaçu, tucumã e dendê. As dietas foram formuladas para serem isonitrogenadas e isoenergéticas, com 7% de EE na MS da dieta total, onde 4% do EE foi oriundo das tortas e o restante dos outros constituintes da dieta. Os animais foram avaliados durante 70 dias e pesados no início do experimento e a cada 14 dias, assim como as avaliações morfométricas e com ultrassom. O consumo foi avaliado durante o trigésimo e trigésimo quarto dia, com coleta da dieta ofertada e rejeitada, assim como coleta das fezes, no ensaio de digestibilidade. Posteriormente, os animais foram abatidos para avaliações quantitativas na carcaça. O tratamento com maior ganho de peso médio total foi o controle, e menor ganho, no tratamento que continha torta de tucumã, com ganho total de 8,40 e 3,87 kg, respectivamente. A utilização de coprodutos na nutrição de ruminantes constitui alternativa para diminuir os custos de produção, porém deve ser utilizada de forma coerente com o sistema de criação, para permitir melhores benefícios.

  • ARNALDO ALGARANHAR GONCALVES
  • EFEITO DA INSULAÇÃO TESTICULAR NA ESPERMATOGÊNESE DE TOUROS BUBALINOS (Bubalus bubalis)

  • Data: 28/02/2018
  • Mostrar Resumo
  • Este estudo tem o propósito de investigar a influência do estresse térmico testicular em reprodutores bubalinos (Bubalus bubalis), de forma a compreender as mudanças morfológicas e moleculares nos espermatozoides associadas aos ciclos e estágios da espermatocitogênese. Foi utilizado cinco touros com média de idade de 7,2 ±3,0 anos, mantidos em baias com acesso a área sombreada e não sombreada. A temperatura do ambiente, umidade relativa do ar, temperatura corporal e testicular foram mensuradas durante todo o período experimental para verificar se tais fatores poderiam anular o efeito térmico da bolsa insuladora testicular. As coletas de sêmen foram realizadas com quatro amostras controles: pré-insulação testicular (-21, 14, -7 e 0) e pós-insulação testicular (7, 14, 21, 28, 35, 42 e 49), divididos de acordo com o ciclo do epitélio seminífero (7º dia de maturação epididimária; 14º, 21º dia espermiogênese; 28º e 32º dia durante a meiose I e meiose II; 42º e 49º dia as espermatogônias). A fixação da bolsa insuladora foi após a ultima coleta de sêmen controle, e permaneceu durante 48 horas. O sêmen foi criopreservado utilizando o diluidor Tes-Tris gema com tempo de 4 horas de equilíbrio e curva de congelação negativa em vapor de nitrogênio por 15 minutos. O experimento 1 foi avaliado as características físicas e morfológicas do sêmen in natura e o teste de termoresistência com sêmen descongelado. O experimento 2 foi analisado a integridade das membranas plasmática, membrana acrossomal, atividade mitocondrial, desprotaminação da cromatina e fragmentação do DNA espermático. No experimento 1 não obteve diferença nas características físicas e no teste de termoresistência ao longo do ciclo espermático, porém houve mudanças morfológicas com aumento da temperatura testicular evidenciado em fase diferentes no epitélio seminífero pelo incremento de patologias de cauda, cabeça e gota citoplasmáticas. No experimento 2 não foi possível observar mudanças nas estruturas das membranas plasmática, atividade mitocondrial e fragmentação do DNA, no entanto, a desprotaminação da cromatina predispuseram com a falha na substituição de proteínas nucleares durante a fase de espermatogônias. Com isso na fase epididimária e final da diferenciação das espermátides as células tendem apresentar elevado número de patologias de cauda fortemente dobrada e gota citoplasmática, já para defeitos de acrossoma e contorno de cabeça foram expressos devido a danos na meiose do epitélio seminífero. Em relação ao empacotamento do DNA, o estresse térmico testicular dificultou a troca das proteínas no DNA durante as divisões mitóticas na espermatogônias.

  • ALINE FERNANDA OLIVEIRA RAMOS
  • Caracterização química de tortas de oleaginosas e avaliação in vitro do uso de tortas de oleaginosas, óleos e extratos vegetais da Amazônia na nutrição e na mitigação da produção de metano em ruminantes

  • Data: 28/02/2018
  • Mostrar Resumo
  • Esta tese objetivou a caracterização química de tortas prensadas de oleaginosas (TPO) e a avaliação in vitro de dietas para ruminantes contendo tortas de oleaginosas, óleos e extratos vegetais da Amazônia como ingredientes moduladores ruminais e da produção de metano, para tal foram desenvolvidos dois experimentos. No primeiro experimento objetivou-se caracterizar a composição de doze TPO e avaliar o efeito do uso de TPO, cinco óleos e dois extratos vegetais amazônicos na cinética de produção de gases in vitro de dietas para ruminantes, usando a técnica semiautomática. Os tratamentos foram arranjados em fatorial inteiramente randomizado, 12×4 (12 TPO, 4 níveis), 2×5×4 (2 tipos de dietas, 5 óleos, 4 doses) e 2×2×4 (2 dietas, 2 extratos, 4 doses) De modo geral, as interações TPO×nível, óleo×dose e extrato×dose não foram significativas (P>0,05), exceto DEIVMS das TPO em 96 h, taxa fermentativa para óleo em dieta com concentrado e CO2 mg g-1 MS para os óleos em dieta volumosa. As TPO são alternativas de ingredientes para alimentação de ruminantes, as de castanha-do-pará, coco, pracaxí e babaçu são opções de ingredientes proteicos e a de bacuri como energético e podem ser incluídos em até 30% da MS de dieta a base de silagem de milho sem prejudicar a degradação in vitro às 96 horas. As tortas e seus níveis, em até 30% da dieta, não afetam de forma geral a produção de metano in vitro até 12 horas de incubação. Os óleos de andiroba, copaíba, tucumã e pracaxí e o resíduo do refinamento do óleo de palma adicionados em até 4% do volume total do inóculo não afetam a produção e concentração de gases in vitro às 12 h de incubação. O mesmo para os extratos vegetais obtidos por Ananas erectifolius (curauá) e Luehea divaricate (açoita-cavalo) nas doses administradas até 200ppm na MS da dieta. No experimento dois, objetivou-se determinar o efeito do óleo de tucumã na fermentação in vitro, produção de gases e microbiologia ruminal, usando o Rusitec, em delineamento inteiramente randomizado com três tratamentos e duas repetições (vasos). Os tratamentos foram: dieta controle; dieta com adição de óleo em 0,5% do volume total do vaso (4mL); e dieta com adição de óleo em 1% do volume total do vaso (8mL). As variáveis mensuradas diariamente foram pH, redox, N-NH3, AGV totais e AGV de cadeia ramificada), produções de gás total, CH4 e CO2 (%, mL/d, e mg/gMS). Amostras de DNA para diversidade da microbiota bacteriana (associada à fase líquida – LAM e associada à fase sólida – SAM) As doses de tucumã não afetaram o pH e AGV totais (P<0,05), no entanto alteraram a proporção molar com aumento de propionato e redução de acetato e butirato (P>0,05) e a maior dose de óleo reduziu a produção de CH4

  • MANOEL ALESSANDRO BORGES DE AVIZ
  • PAPEL DE BACTÉRIAS PROBIÓTICAS NO CULTIVO DE LARVAS DE Macrobrachium amazonicum(Heller, 1862).

  • Data: 26/02/2018
  • Mostrar Resumo
  • O uso de probióticos tem mostrados resultados promissores de crescimento, sobrevivência e contribuição enzimática em peixes e crustáceos. Vários estudos apontam os efeitos promissores de probióticos comerciais e aqueles selecionados de animais espécie-específica, com propósito de ser adicionado ao cultivo de larvas, pós-larvas, formas jovens e indivíduos adultos. Resultados promissores tem sido mostrados no cultivo de camarões de água doce, principalmente nas fases de pós larvas, juvenis e adultos. Na fase de larvicultura são poucos os estudos mostrando melhorias nos índices zootécnicos com o uso de bactérias probióticas. Este estudo avaliou o uso de duas formas de probiótico: comercial e customizado no cultivo de larvas do camarão-da-amazônia. Foram avaliados os índices de sobrevivência, produtividade, peso fresco, comprimento, IEL e ICL, bem como, a qualidade da água, principalmente amônia e nitrito. Foram analisados a colonização do trato gastrointestinal a partir da inclusão dos probióticos na dieta e na água de cultivo. Os resultados deste estudo mostrou que o uso de bactérias probióticas não teve impacto significativo (p<0,05) sobre os indicies de sobrevivência, produtividade, comprimento, peso fresco, IEL e ICL. Sobre os parâmetros de qualidade de água também não foram obtidos resultados melhorados. O trato gastrointestinal das larvas não foi colonizado pelas bactérias probióticas quando estas foram adicionadas apenas na água de cultivo. A partir da inclusão do probiótico na dieta, foi possível observar que houve sucesso na colonização. Esses resultados mostram que na fase larval de Macrobrachium amazonicum, o uso de probióticos não representam ganhos zootécnicos que justifiquem sua recomendação.

2017
Descrição
  • CINTHIA TAVORA DE ALBUQUERQUE LOPES
  • Isolamento de células derivadas da pele de macacos Sapajus apella (Linnaeus, 1758) para fins de aplicação em biotécnicas reprodutivas

  • Data: 20/12/2017
  • Mostrar Resumo
  • Células-tronco presentes nos compartimentos da pele são indispensáveis para a manutenção da homeostase, regeneração, reparação tecidual e reconstrução da integridade e funcionalidade após lesões. Em 2001 um protocolo de isolamento de precursores neurais foi adaptado para o isolamento de células-tronco da pele, referidas como “precursores derivados da pele” (SKPs), as quais foram diferenciadas, posteriormente, em células da linhagem germinativa, abrindo, assim, uma via de exploração para aplicações em biotecnologias da reprodução. Outro relevante aspecto sobre a pele, são as metodologias desenvolvidas para sua conservação e manutenção por longos períodos, o que permite a estocagem de suprimento biológico para inúmeras pesquisas, inclusive em biologia da conservação e criobiologia. Nesse contexto, considerando-se a necessidade de novas técnicas que contribuam para a preservação de espécies de primatas neotropicais, este trabalho tem como proposta o isolamento de células derivadas da pele de macacos Sapajus apella buscando-se, em acréscimo, o estabelecimento de um protocolo de criopreservação das amostras para posterior utilização em biotécnicas reprodutivas.

  • MAYRA PAULINE RIBEIRO COSTA
  • Isolamento e análise do potencial de células tronco MUSE (multilineage-differentiating stress-enduring) derivadas de fetos bovinos 

  • Data: 31/10/2017
  • Mostrar Resumo
  • As pesquisas com células tronco são importantes por causa das variadas aplicações. As células tronco adultas são de fácil obtenção, porém possuem um menor potencial. A pele é o maior órgão do corpo e são variadas as células que compõe os tecidos, dentre elas, fibroblastos e SKPs estão em maior quantidade na região da derme. SKPs são células multipotentes encontradas na região da derme que possuem o potencial de diferenciação em diversas células, como da linhagem neuronal e células germinativas. Estudos recentes relataram que é possível obter células na pele com capacidade diferenciação nas três linhagens germinativas e marcadores específicos como SSEA-3 e CD105 e que essas células podem ser separadas por meio de estresse com tripsina, são chamadas de MUSE.  Assim, o objetivo deste trabalho é estabelecer células MUSE e gerar SKPs a partir de fibroblastos fetais de bovinos, visando futura aplicação em biotecnologias reprodutivas. Para isso, fibroblastos fetais bovinos foram submetidos a estresse de 3 horas a 37ºC, seguido de 18 horas a 4ºC e cultivados em meio DMEM/F12 mais fatores de crescimento e B27 durante 3 e 6 dias. As avaliações foram quantificação do numero de esferas formadas, ensaio de fosfatase Alcalina e imonocitoquímica. Os resultados mostraram que as células MUSE foram estabelecidas e geraram esferas a partir de fibroblastos fetais bovinos com marcação positivas células multipotentes. Porém, foram negativas para fosfatase alcalina que é marcador de pluripotência, além de serem de menor qualidade quando comparadas ao grupo controle, indicando que não são indicadas para formação de SKPs.

  • THAYS SYNTYA ANTUNES DA COSTA
  • INFLUÊNCIA DA DIETA COM TRÊS TIPOS DE ÓLEOS NAS VARIÁVEIS QUANTITATIVAS E QUALITATIVAS DA CARCAÇA E DA CARNE DE OVINOS

  • Data: 30/10/2017
  • Mostrar Resumo
  • Este projeto visou avaliar as características quantitativas e qualitativas da carcaça e da carne de ovinos alimentados com diferentes tipos de óleos, no Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA/Campus Castanhal, Pará. Foram utilizados 30 cordeiros machos não castrados, mestiços Santa Inês × Dorper, com peso corporal médio inicial de 21±3 kg, distribuídos em delineamento em blocos ao acaso, com três tratamentos e dez repetições por tratamento, onde cada animal representa uma repetição, em três dietas experimentais: T1 - óleo de soja integral; T2 - óleo de soja após processo de fritura; e T3 - óleo de palma, com nível de 4% de inclusão de óleo. As dietas foram formuladas na proporção volumoso concentrado de 40:60, constituídas de silagem de capim elefante (Pennisetumpurpureum, Schum.) e milho moído, farelo de soja, farelo de trigo, óleo do tratamento, calcário calcítico e ureia. Os animais foram alimentados duas vezes ao dia, às 8h:00 e 16h:00, e o período experimental duração de 80 dias, Após esse período os animaisforam abatidos, após 12 h de jejum alimentar e dieta hídrica. As carcaças foram avaliadas, através de mensurações morfométricas, pH, temperatura, rendimento quente e frio, área de olho de lombo, espessura de gordura de cobertura e marmoreio, além de tipificação da carcaça. Serão feitas análises no músculo Longissimusdorsi, para determinação de cor, pH, perda de peso por cocção, força de cisalhamento e capacidade de retenção de água.Os dados foram submetidos à análise de variância e as médias das variáveis comparadas por Tukey a 5% de probabilidade, com uso do SAS (2008). Dentre os parâmetros avaliados não houve diferença estatística, portanto, considera-se viável a utilização de qualquer um três tipos de óleo, em função apenas das características quantitativas e qualitativas da carcaça e da carne de ovinos, pois deve ser levado em consideração, também, as questões ambientais, sociais e econômicas, havendo a possibilidade de substituição de alimentos convencionais por óleo residual de fritura e subprodutos da agroindústria na alimentação de ovinos como alternativa interessante.

  • LUIZ FERNANDO SILVA OLIVEIRA
  • Efeito do ambiente no desenvolvimento de ostra-do-mangue Crassostrea gasar (Adanson, 1757) em ambientes tropicais

  • Data: 15/09/2017
  • Mostrar Resumo
  • A malacocultura é uma das atividades aquícolas mais promissoras. No entanto, em regiões costeiras e estuarinas tropicais, como os manguezais amazônicos, a salinidade é apontada como um dos principais fatores limitantes ao cultivo de moluscos bivalves. Desse modo, o objetivo do presente estudo foi avaliar se a sazonalidade e a localização do cultivo interferem no crescimento e na modulação das proteínas apoptóticas envolvidas na maturação gonadal de ostra-do-mangue Crassostrea gasar e quais os fatores ambientais que mais influenciam no desempenho do cultivo ao longo do ano. As ostras analisadas foram cultivadas por um período de um ano em cultivos distribuídos de acordo com a distância em relação ao oceano em três diferentes áreas de manguezal ao longo da costa amazônica. Nesses cultivos, as ostras foram mantidas em sistemas de mesa-fixa. O estudo foi dividido em quatro períodos sazonais: transicional chuvoso-seco, seco, transicional seco-chuvoso e chuvoso. Salinidade, pH, temperatura e concentração de oxigênio dissolvido na água foram medidos in situ por uma sonda multiparâmetros durante a coleta dos espécimes. Uma média de 20 exemplares foi coletada mensalmente em cada área de cultivo. Após as coletas foi realizada a biometria a fim de avaliar o peso e o tamanho das ostras e técnicas histológicas e imunohistoquímica para avaliar a atividade gonadal. Dos fatores abióticos analisados, a salinidade e precipitação foram os parâmetros que mais variaram, e diferiram significativamente entre as áreas, ao longo de todo o estudo. Observamos que as ostras atingiram maior tamanho nos cultivos em áreas com menor distância em relação ao mar, e que durante o estádio imaturo e desova, o ovário apresenta a maior expressão de proteínas apoptóticas, especialmente nas células foliculares e oogônias nas fases iniciais, e nos oócitos vitelogênicos residuais após desova. Por outro lado, a expressão da proteína antiapoptótica Bcl-2 ocorre principalmente nas células do manto. Concluímos que os cultivos localizados mais próximos à costa amazônica foram as áreas indicadas ao cultivo em escala comercial, enquanto o cultivo que possui maior distância em relação ao oceano e maior influência de rio, não favorece o crescimento das ostras, e a maior ocorrência de apoptose nos estágios imaturo e desovado desempenha um papel de regulador da população celular, no entanto não compromete a maturação da gônada, sugerindo uma possível resposta ao estresse causado ao animal  durante a atividade reprodutiva.

  • PRISCILA DI PAULA BESSA SANTANA
  • Perfil transcriptômico de oócitos maturados e blastocistos de búfalo (Bubalus bubalis) produzidos in vitro.

  • Data: 01/09/2017
  • Mostrar Resumo
  • A espécie bubalina é de grande potencial econômico e industrial, no entanto este potencial está subaproveitado. Isso se deve, entre outros fatores, a baixa eficiência das biotecnologias reprodutivas usadas em búfalos, com destaque para a produção in vitro de embrião (PIVE) que, apesar das limitações, têm se mostrado a mais promissora para a multiplicação de rebanhos bubalinos. Para mudar esse panorama, é essencial conhecer o funcionamento de oócitos e embriões bubalinos. Através das análises de perfil de transcrição usando PCR tempo real e microarranjos tem sido feitos muitos avanços no entendimento do metabolismo e mecanismos de desenvolvimento de embriões de espécies domésticas relacionadas, como os bovinos. E, atualmente, ganharam grandes proporções com o advento da tecnologia de sequenciamento de nova geração (RNAseq). Consequentemente, o entendimento de aspectos moleculares da maturação oocitária e do desenvolvimento embrionário, têm contribuído para a elaboração de meios de cultivo mais adequados as necessidades dos embriões, para a compreensão dos mecanismos genéticos de regulação da maturação oocitária e de ativação do genoma embrionário e dos aspectos moleculares da qualidade oocitária e embrionária. Este trabalho propõe o uso de RNAseq para o estudar o transcriptoma de oócitos maturados e blastocistos bubalinos produzidos in vitro. O conhecimento do perfil de expressão de oócitos e embriões de búfalo poderá auxiliar na elaboração de futuras estratégias de aprimoramento da PIVE.

  • JOAO MARIA DO AMARAL JUNIOR
  • Consumo, cinética ruminal e produção de metano em búfalas suplementadas com níveis crescentes de torta de palmiste no Bioma Amazônia

  • Data: 31/08/2017
  • Mostrar Resumo
  • Com o objetivo de avaliar os efeitos da torta de palmiste, ofertada em níveis crescentes (0%; 0,25%; 0,5% e 1,0%) em relação ao peso corporal (PC) de búfalas, sem raça definida, secas e vazias, sendo associado a cada nível das dietas a inclusão 0,15% (PC) de farelo de trigo em todos os tratamentos. Mensurou-se o consumo voluntário, o comportamento ingestivo, a degradabilidade ruminal das dietas e a produção entérica de metano de bubalinos no Bioma Amazônia, onde foram conduzidos três experimentos na Embrapa Amazônia Oriental, Belém/PA. O experimento 1 (Consumo voluntário e comportamento ingestivo) foi desenvolvido no período de junho de 2013 a setembro de 2014, com 24 búfalas, que ficaram em piquetes de Brachiaria brizantha cv. Marandu, criadas em sistema de pastejo intermitente, com acesso a água e mistura mineral ad libitum. O experimento 2 (Degradabilidade ruminal in situ) ocorreu no período de agosto a novembro de 2014, com 04 búfalas portadoras de cânula ruminal, criadas nas mesmas condições do experimento 1. Conduziu-se no período de abril a novembro de 2015, o experimento 3 (Emissão entérica de metano), com 20 búfalas, nas quais os animais foram manejados em sistema de confinamento, divididos em baias individuais, onde receberam a silagem de milho (volumoso) e a suplementação energética, com acesso a água e mistura mineral ad libitum. O primeiro experimento, que gerou o Artigo 1, objetivou avaliar o consumo voluntário e o comportamento ingestivo (através do método de varredura instantânea por 24 horas) de fêmeas bubalinas, onde receberam as ofertas dos níveis crescentes da torta de palmiste e mantidas em sistema de lotação intermitente. Foram calculadas as dietas e coletadas as sobras diariamente, durante o período experimental. Os animais receberam alimentação diária, em cochos individuais e a dieta foi ajustada, mediante a novo ciclo de pesagem dos animais, a cada 28 dias. Observou-se que o nível máximo de consumo da torta de palmiste na dieta de búfalas é de 0,7 % do PC, e, não houve influência nos parâmetros de desempenho nos níveis ofertados de suplementação. Os níveis de ofertas experimentais não alteram o comportamento ingestivo (pastejo, ruminação, ócio) de búfalas criadas a pasto. A degradabilidade ruminal da Brachiaria brizantha cv. Marandu, do farelo de trigo e da torta de palmiste, avaliadas no segundo experimento, na qual gerou o Artigo 2, utilizando a técnica do saco in situ no rúmen. Foram utilizadas 04 búfalas mestiças com cânula ruminal, em quadrado latino 4 x 4 (4 períodos e 4 tratamentos), onde foram suplementas com os mesmos níveis de oferta da torta de palmiste citados e acesso aos piquetes de Brachiaria brizantha cv. Marandu, em 4 períodos experimentais de 25 dias cada, com 21 dias de adaptação dos animais às dietas e incubação in situ dos alimentos por um período de quatro dias, sendo utilizados os seguintes tempos de incubação: 0, 6, 12, 24, 48, 72 e 96 horas, a exceção do farelo de trigo que foi incubado até as 48 horas, sendo os sacos colocados em ordem inversa, para serem retirados todos ao mesmo tempo.  A suplementação da torta de palmiste não afeta a degradabilidade da matéria seca da gramínea experimental, apesar de ter promovido uma melhor degradação da fração fibrosa. O terceiro experimento, que gerou o Artigo 3, visou avaliar os efeitos dos níveis de oferta da torta de palmiste na produção de metano entérico (CH4) em búfalos na Amazônia. As análises deste experimento mostraram variação na produção de metano quanto aos diferentes níveis de oferta da torta de palmiste. A emissão de CH4 foi menor no tratamento com o maior nível de oferta da torta de palmiste (1,0%) em relação ao PC (26,43 kg/ano) quando comparado ao grupo controle que produziu média de (66,04 Kg/ano). Concluiu-se que o nível máximo de torta de palmiste consumida pelas búfalas criadas em pasto de Brachiaria brizantha cv. Marandu foi de 0,7% do PC, não afetando o consumo e o desempenho animal, a suplementação das dietas experimentais não influencia no comportamento ingestivo das búfalas e não afeta a degradabilidade da MS da Brachiaria brizantha cv. Marandu, e, a oferta em níveis acima de 0,5% do PC de torta de palmiste na dieta diminui a emissão de metano de bubalinos.

  • AMANDA DE SOUSA MATOS
  • Avaliação genética de características leiteiras de búfalos (Bubalus bubalis) do Brasil.

  • Data: 01/08/2017
  • Mostrar Resumo
  • O objetivo deste trabalho foi estimar a influência de fatores ambientais nas características fenotípicas de produção leiteira, realizar a avaliação genética por meio da estimação das herdabilidades e tendências genéticas para a produção total de leite, e a partir desses dados, gerar um ranking de touros e matrizes geneticamente superiores de búfalos (Bubalus bubalis) provenientes das cinco regiões do Brasil. Foram utilizados dados de controle leiteiro e controle zootécnico perfazendo um total de 9.326 registros de partos de 1969 a 2016, com informações de produção total de leite corrigida para 305 dias (PTL), duração da lactação (DL) e percentual de gordura (%G) de fazendas aderidas à Associação Brasileira dos Criadores de Búfalos, e de Unidades da Empresa Brasileira de Pesquisa Agropecuária. Para a análise descritiva realizou-se a ANOVA, utilizando no modelo o efeito fixo de fazenda, estação de parto (EP), interação fazenda*estação de parto e a classe da idade da búfala ao parto (CIBP), e o animal como efeito aleatório. A comparação de médias foi obtida pelo teste de Tukey. A média de produção foi 1.963,42+713,94kg, 281,71+53,89 dias e 7,07+0,86%, com influência dos fatores de fazenda, interação fazenda*EP e CIBP; fazenda, EP e interação fazenda*EP; e CIBP para PTL, DL e %G, respectivamente. As correlações fenotípicas foram 0,32, 0,03 e 0,26 para PTL e DL, PTL e %G, e DL e %G, respectivamente. Para estimação de componentes de variância foram utilizados 3.486 registros de produção total de leite através do programa BLUPF90, posteriormente, foram preditos os valores genéticos dos animais para a produção de leite. As estimativas de tendência genética e fenotípica foram obtidas pelo método de regressão linear fazendo a regressão dos valores genéticos e fenotípicos sobre o ano de parto e ano de produção, respectivamente. A herdabilidade encontrada foi de 0,27 para produção de leite, e a PTA (Predicted Transmitting Ability) de valor mais elevado encontrado neste estudo foi de 203,40 e 207,39 de touros e matrizes, respectivamente. O gráfico de tendência genética formou uma linha quase continua, tendendo a um discreto ganho genético, já a tendência fenotípica demonstrou um avanço na produção de leite principalmente a partir da década de 90. Portanto, A produção de leite, duração da lactação e o percentual de gordura, são características passíveis de seleção, e apesar da baixa magnitude, a herdabilidade encontrada neste estudo ocasionaria ganho genético nos rebanhos caso fossem utilizados touros e matrizes provados e de alto valor genético para a característica estudada, tornando a bubalinocultura uma atividade promissora.

  • NARIAN ROMANELLO
  • Avaliação da qualidade do sêmen de touros Canchim (Bos taurus x Bos indicus) sob diferentes condições climáticas e tratamento hormonal

  • Data: 30/06/2017
  • Mostrar Resumo
  • O presente estudo visou aprimorar o conhecimento sobre as características fisiológicas e andrológicas de machos bovinos de raça composta em ambiente tropical e sob tratamento hormonal. No primeiro ensaio, foram utilizados 18 touros da raça Canchim (5/8 Charolês x 3/8 Zebu). Mensalmente, os animais foram avaliados quanto aos parâmetros fisiológicos (frequência respiratória e temperatura retal), hematológicos (hemograma completo), temperaturas da superfície corporal (globo ocular, flanco direito e escroto) e níveis hormonais (cortisol, triiodotironina-T3 e testosterona). Foram também realizadas as avaliações de integridade de parênquima testicular e qualidade seminal, além do calculo do Índice de Temperatura e Umidade e do Índice de Conforto de Benezra. Os dados mensais foram agrupados por estação climática (Inverno, Primavera e Verão), para monitoramento sazonal e comparação entre estações. No segundo ensaio, foram utilizados 20 touros da raça Canchim, divididos em quatro grupos, de acordo com sua qualidade seminal e de acordo com tratamento com GnRH (hormônio liberador de gonadotrofina) ou placebo. Assim, os grupos foram determinados: BQS+P: animais com baixa qualidade seminal tratados com placebo (n=5); BQS+H: animais com baixa qualidade seminal tratados com GnRH (n=5); AQS+P: animais com alta qualidade seminal tratados com placebo (n=5) e AQS+H: animais com alta qualidade seminal tratados com GnRH (n=5). O ensaio foi dividido em três fases: pré-tratamento, que considerou as médias das avaliações 18 dias antes do tratamento instituído (Pré -18D); tratamento, que considerou como D0 o primeiro dia de tratamento hormonal; e pós-tratamento, que se estendeu de 5D a 73D. Os animais foram avaliados quanto a temperatura de superfície escrotal, níveis séricos de testosterona, integridade de parênquima testicular e qualidade seminal. Os touros apresentaram eficiência termorregulatória mesmo em condições ambientais de maior desafio, que ocorreram nas estações de Primavera e Verão, sem alterações fisiológicas, hematológicas, nas temperaturas corpóreas, nos níveis hormonais e nos parâmetros andrológicos. A administração do hormônio GnRH mostrou-se eficiente para elevação da motilidade espermática progressiva, principalmente em touros de baixa qualidade seminal.

  • JULIETTE DO SOCORRO PEREIRA PANTOJA
  • EUGENOL COMO ANESTÉSICO PARA O PEIXE ORNAMENTAL AMAZÔNICO ACARÁ BANDEIRA Pterophyllum scalare (Schultze, 1823) EM DIFERENTES FASES DE DESENVOLVIMENTO


  • Data: 26/05/2017
  • Mostrar Resumo
  • O manejo de peixes em cultivo é um processo estressante que pode causar injúrias aos animais e deixá-los susceptíveis a diversas doenças. Dessa forma, o uso de anestésicos na aquicultura surge com intuito de facilitar o manejo durante o processo produtivo. Dentre os fármacos utilizados, o eugenol é um anestésico natural, que não causa danos ao animal nem ao manipulador e tem sido utilizado largamente nos processos de produção de peixes em cativeiro. No entanto, antes de sua utilização, é necessário estabelecer uma dose ideal para cada espécie e levar em consideração o estágio de vida do animal. Portanto, com o presente trabalho objetivou-se avaliar a eficiência do eugenol como agente anestésico em diferentes fases de vida do acará-bandeira Pterophyllum scalare.   Três experimentos foram conduzidos no Laboratório de Peixes Ornamentais da Faculdade de Engenharia de Pesca do Instituto de Estudos Costeiros da Universidade Federal do Pará, Campus de Bragança. Foram utilizados 180 indivíduos de P.scalare, divididos em três classes de tamanho: alevinos (n=60) com 0,048 ± 0,010 g e 1,16 ± 0,29 cm, juvenis (n=60) com 1,23 ± 0,31 g e 3,37 ± 0,38 cm e adultos (n=60) com 13,53 ± 3,92 g e 6,85 ± 0,78 cm . Os alevinos e juvenis foram selecionados em tamanhos homogêneos e transferidos aleatoriamente para seis aquários de 60 L em uma densidade de estocagem de 10 exemplares por aquário. Em mesma densidade, os adultos foram selecionados em tamanhos homogêneos e transferidos aleatoriamente para seis aquários de 200L. Após novo período de adaptação, 15 dias, os experimentos foram realizados de forma independente em um delineamento experimental inteiramente casualizado com seis concentrações de eugenol (50, 75, 100, 125, 150 e 175 mg L-1) e dez repetições, considerando cada exemplar como uma repetição. A sobrevivência 96 horas após a indução e recuperação foi de 100% em todas as concentrações avaliadas. Concentrações de eugenol de 50, 75 e 100 mg L-1 apresentaram maior tempo de indução à anestesia leve em alevinos e juvenis.  Por outro lado, as concentrações anestésicas de 125, 150 e 175 mg L-1 proporcionaram os menores tempos de indução à anestesia leve nestas fases. As maiores concentrações, 150 e 175 mg L-1 levaram a um menor tempo de indução dos adultos ao estágio de anestesia leve. No entanto, os indivíduos anestesiados com as concentrações de 50, 75, 100 e 125 mg L-1 de eugenol apresentaram maior tempo para indução a este estágio de anestesia. Os tempos de indução à anestesia profunda dos alevinos nas concentrações de 50 mg L-1, seguida da de 75 mg L-1, foram superiores as demais concentrações de eugenol. Já os exemplares submetidos às concentrações de 100, 125, 150 e 175 mg L-1 de eugenol demonstraram menor tempo de indução a este estágio de anestesia. O tempo de indução à anestesia profunda dos juvenis na concentração de 50 mg L-1 de eugenol foi superior as demais concentrações. Já os exemplares submetidos às concentrações de 75, 100, 125, 150 e 175 mg L-1 de eugenol demonstraram menor tempo de indução a este estágio de anestesia. Adultos submetidos nas concentrações de 50 e 75 mg L-1 de eugenol apresentaram maior tempo para alcançar o estágio de anestesia profunda, enquanto a concentração de175 mg L-1 foi a que os peixes apresentaram menor tempo de indução a este estágio de anestesia. As concentrações de 50, 75, 100 e 125 mg L-1 de eugenol levaram a um menor tempo de recuperação dos alevinos à anestesia profunda. Enquanto os peixes submetidos nas concentrações de 150 e 175 mg L-1 demonstraram maior tempo recuperação. Os tempos de recuperação dos juvenis submetidos às concentrações de 125, 150 e 175 mg L-1 de eugenol foram superiores aos das concentrações de 50, 75 e 100 mg L-1. As diferentes concentrações de eugenol utilizadas para submeter os adultos ao estágio de anestesia profunda não influenciaram significativamente no tempo de recuperação destes indivíduos. Portanto, os experimentos demonstram que o eugenol pode ser considerado um anestésico eficiente para P.scalare. Assim, baseado na dose minimamente eficaz, recomenda-se a concentração de 50 mg L-1 de eugenol nas classes de tamanho analisadas para fins de manejo, uma vez que o uso de maiores dosagens acarretaria em desperdício do fármaco e maior custo econômico.

  • DENYS ROBERTO CORREA CASTRO
  • ASPECTOS ECONÔMICOS DA CRIAÇÃO DE TAMBAQUI Colossoma macropomum (Cuvier, 1816) NO ESTADO DO PARÁ: PRODUÇÃO DE ALEVINOS E ENGORDA

  • Data: 17/05/2017
  • Mostrar Resumo
  • A piscicultura continental é o ramo da aquicultura mais desenvolvido no estado do Pará, tendo o tambaqui Colossoma macropomum como principal espécie produzida. No entanto, a maioria dos piscicultores ainda não realiza o planejamento dos empreendimentos e os controles zootécnico e financeiro com o devido rigor. Essa situação dificulta as tomadas de decisão em relação ao investimento, pois inviabiliza o conhecimento de aspectos econômicos fundamentais do negócio, como o custo de produção e a rentabilidade. O objetivo deste estudo foi analisar aspectos econômicos da produção de alevinos e da engorda de tambaqui no estado do Pará. Adotou-se a estrutura de custo operacional e indicadores de eficiência econômica para avaliar um empreendimento hipotético de produção de alevinos na mesorregião Nordeste paraense e duas pisciculturas de engorda, uma na mesorregião do Baixo Amazonas, onde as estruturas de criação eram gaiolas flutuantes, e outra no Nordeste paraense, onde a atividade era praticada em viveiros escavados. Em janeiro de 2016, o custo de implantação do empreendimento de produção de alevinos com 0,3 hectare de lâmina d’água foi estimado em R$ 278.502,00 e o custo operacional efetivo em R$ 86.920,39. A receita bruta foi de R$ 150.000,00, o lucro operacional mensal de R$ 3.456,87, o valor presente líquido de R$ 83.137,48, a taxa interna de retorno de 20% e o período de retorno do capital de 4,3 anos, respectivamente. Em dezembro de 2015, o custo de implantação da piscicultura em 12 gaiolas flutuantes de 4 m3 de volume útil foi estimado em R$ 20.592,00 e o custo operacional efetivo em R$ 16.890,00. A receita bruta foi de R$ 27.000,00, o lucro operacional mensal de R$ 683,30, a taxa interna de retorno de 48%, o valor presente líquido de R$ 30.839,18 e o período de retorno do capital de dois anos. Em novembro de 2015, o custo de implantação da piscicultura em 12 viveiros escavados de 1.200 m2 foi estimado em R$ 92.465,00 e o custo operacional efetivo em R$ 66.746,00. A receita bruta foi de R$ 100.800,00, o lucro operacional mensal de R$ 2.521,63, a taxa interna de retorno de 36%, o valor presente líquido de R$ 129.285,07 e o período de retorno do capital de 2,7 anos. As pisciculturas analisadas mostraram-se investimentos rentáveis, inclusive com capacidade de maximização do lucro, caso sejam adotadas estratégias produtivas mais adequadas.

  • MESSY HANNEAR DE ANDRADE PANTOJA
  • Características termolíticas de machos ovinos de genótipos naturalizados ou exóticos criados em ambiente tropical

  • Data: 19/04/2017
  • Mostrar Resumo
  • O presente estudo teve como objetivo avaliar e comparar as respostas relacionadas à termorregulação corpórea de reprodutores ovinos de raças naturalizadas (Morada Nova e Santa Inês) e raças exóticas (Dorper e Texel), para gerar informações que possam ser usadas na seleção de animais mais produtivos em regiões de clima tropical. O experimento foi conduzindo na Embrapa Pecuária Sudeste, São Carlos-SP, local no qual incide o clima tropical de altitude (Cwa). Foram utilizados 33 machos ovinos de quatro genótipos distintos, puros: Morada Nova (n=8), Santa Inês (n=9), Dorper (n=8) e Texel (n=8), com peso médio de 67,6±6,9 kg e com idade média de 20,1±3,1 meses, mantidos em regime de confinamento, em área com acesso permanente à sombra. O período experimental ocorreu de agosto de 2015 a julho de 2016 e compreendeu quatro estações climáticas. Foram mensuradas, mensalmente, temperatura de superfície corporal por meio de termografia de infravermelho, a espessura de pelame e realizada colheita de sangue. Quinzenalmente, foram avaliadas a temperatura retal, frequência respiratória e frequência cardíaca. Foram coletados fragmentos de pele no verão e inverno. Os efeitos de genótipo e tempo foram considerados no modelo matemático para análise estatística. A espessura de pelame foi maior para os animais Texel ao longo das estações (P<0,05). Foi observada diferença racial nas variáveis fisiológicas estudadas (P<0,05). Menores valores de T3 foi observados para a raça Texel (P<0,05). Foi observada diferença na temperatura de superfície das raças exóticas (P<0,05). Houve diferença nos parâmetros hematológicos e nas características morfológicas de pele de ovinos ao longo das estações do ano. Desta forma, as raças naturalizadas apresentaram maior capacidade termolítica, enquanto a raça Texel se mostrou mais sensível às condições climáticas da região. Ovinos Dorper, apesar de serem considerados como uma raça exótica às regiões tropicais, apresentaram capacidade intermediária de se ajustarem sob condições climáticas adversas.

  • RODRIGO DE MORAIS
  • HORMÔNIO ANTIMULLERIANO SÉRICO COMO PREDITOR DA RESERVA FOLICULAR OVARIANA EM BEZERRAS BÚFALAS (Bubalis bubalis)

  • Data: 12/04/2017
  • Mostrar Resumo
  • O búfalo é um animal de grande interesse no Brasil e no mundo, principalmente pela qualidade do leite além da produção de carne.  No entanto o uso de biotecnologias reprodutivas que visam a multiplicação do material genético materna ainda apresenta grande limitações principalmente pelo pequeno tamanho do ovário e reduzido numero de folículos. Nesse sentido o presente trabalho tem por objetivo avaliar a correlação dos níveis sanguíneos do hormônio antimulleriano (AMH) em bezerras búfalas (Bubalis bubalins) da raça Murrah com a reserva folicular ovariana na vida adulta. Serão utilizadas 30 bezerras búfalas apartadas na desmama com idade média de 8 meses. Os animais serão submetidos a duas dosagens de AMH, aos 8 e aos 18 meses, ao atingirem estrutura anatômica compatível será avaliado a população de folículos antrais (PFA) mediante a utilização exame ultrassonográfico por via trans retal. A partir dos 12 meses serão dosados os níveis de progesterona (P4) para a determinação da puberdade, durante todo o acompanhamento os animais serão pesados mensalmente. Os dados da PFA e os níveis de AMH serão confrontados pela correlação de Pearson. Os níveis de P4 ao longo do tempo serão analisados mediante a análise de variância (ANOVA) em duas vias (2 critérios). Todos os dados serão analisados ao nível de 5% de probabilidade.

  • JOSE GEISON RIBEIRO SILVA
  • Análise sensorial, morfometria corporal e rendimento de corte de “diferentes” espécies de tucunarés (Cichla, Perciformes), provenientes da UHE Tucuruí, Estado do Pará.

  • Data: 17/03/2017
  • Mostrar Resumo
  • Este trabalho teve por objetivo avaliar o perfil de características sensoriais e estimativas de qualidade, segundo o grau de frescor, bem como avaliar as relações morfométricas corporais e os rendimentos de cortes de filés em escala industrial de 03 espécies de tucunarés (Tinga, putanga e açú), desembarcados no porto do 11, localizado no lago da Usina Hidrelétrica do município de Tucuruí, Estado do Pará. Foram utilizados 90 exemplares para análise sensorial separados em três grupos por espécies, os atributos sensoriais foram julgados por 30 candidatos de ambos os sexos, com idades variando entre 16 e 45 anos.  Na análise morfométrica e rendimentos de filé os 90 exemplares foram distribuídos em três classes de peso, (F1= <300 g, F2= 301-400 g e F3 = >400 g) em delineamento inteiramente casualisado com 10 repetições por faixa de peso. Os animais foram mensurados quanto ao comprimento total (CT), comprimento padrão (CP), comprimento da cabeça (CC), comprimento do tronco (CTR), altura do tronco (ATR), altura da cabeça (AC) e largura do tronco (LTR). A equipe de julgadores, em consenso, definiu a terminologia mais apropriada, considerando os atributos de aparência visual, sensação olfativa e textura manual, totalizando nove atributos sensoriais, estimando ao final a qualidade do pescado segundo seu grau de frescor. Os dados sensoriais, morfométricos e de rendimentos foram avaliados estatisticamente utilizando o software Statistica 7.0, através da ANOVA e do teste de médias de Tukey, com nível de erro de 5%. Utilizou-se ainda somente para os dados sensoriais o software Primer 6.0 para a análise de componente principal (ACP) para expressar a média dos resultados obtidos na forma gráfica bidimensional. Ambas as espécies obtiveram a estimativa de qualidade sensorial classificada como “Bom”, tendo pontuações do grau de frescor de 28,27 (putanga), 30,53 (açú) e 28,13 (tinga). Verificou-se um percentual de 53,4% das variações explicados pelos dois primeiros fatores (eixos), isto demonstra que os descritores empregados descriminaram satisfatoriamente os peixes analisados. As maiores relações CC/AC e LTR/CTR foram encontradas no tucunaré Açú nas faixas F2 e F3. As relações LTR/CTR e LTR/ATR não apresentaram efeito significativo para as diferentes classes de peso. Para o rendimento de filé sem pele houve uma variação de 40,53% a 47,37%, com melhor rendimento determinado em 39,30% ± 5,75 para o tucunaré Açú na F1 (<300 g).

  • BRUNO CABRAL SOARES
  • PERFIL DAS UNIDADES PRODUTORAS E ÍNDICES DE DESEMPENHO PRODUTIVO DA PECUÁRIA LEITEIRADE RONDON DO PARÁ, ESTADO DO PARÁ


  • Data: 09/03/2017
  • Mostrar Resumo
  • O objetivo do trabalho foi caracterizar as propriedadesleiterias,avaliar o nível tecnológico e o desempenho produtivo através de variáveis e determinar índices de desempenho produtivo da pecuária leiteira (IDPL) de Rondon do Pará, estado do Pará, para direcionar a adoção de inovações tecnológicas que promovam o desenvolvimento sustentável das unidades produtoras de leite do município, e dar suporte para o crescimento da cadeia produtiva. Os dados foram coletados a partir de entrevistas, com utilização de questionários, realizadas em 55 propriedades leiteiras, selecionados com o auxilio da técnica bola de neve, que juntas possuíam 43,3% de vacas ordenhadas do município, em 2014. Foram consideradas informações sobre identificação do proprietário; caracterização da unidade de produção e da exploração leiteira; máquinas e equipamentos; instalações e benfeitorias; sanidade do rebanho; práticas de ordenha e manejo do rebanho. Os dados foram analisados no software IBM SPSS 20.0. Estimou-se um modelo fatorial para identificar o conjunto de fatores que caracterizam o desempenho produtivo da pecuária leiteira, a partir de 14 variáveis representativas das 55 unidades de produção de leite do município. Foram extraídos cinco fatores: F1 = Tamanho do empreendimento; F2 = Assistência técnica e práticas de manejo, F3 = Meio ambiente e nutrição, F4 = Perfil sociodemográfico e F5 = Sanidade animal, a partir dos escores associados a cada fator foi possível estimar o Índice de Desempenho Produtivo da Pecuária Leiteira (IDPL). EmRondon do Pará constatou-se que a idade média dos entrevistados é de 57,41 anos. Os produtores possuem baixo nível de escolaridade, com predominância do ensino fundamental incompleto e a maioria (98%) realizava ordenha manual, e quanto à higienização da ordenha, menos de 2% lavavam as mãos, antes da ordenha, e apenas 10% higienizavam as tetas dos animais. A alimentação animal, no período chuvoso do ano, é feita a pasto, por 98% dos produtores, e apenas 2% complementaram a dieta com volumosos. As propriedades foram classificadas em três níveis de desempenho produtivo: duas propriedades com nível alto; 13 com intermediário; e 40 com nível baixo. Chama atenção à quantidade de propriedades consideradas de nível baixo de desempenho produtivo, o que indica deficiências da atividade no munícipio. A produção leiteira utilizava baixo nível tecnológico, com produtividade média de 5,5 litros/vaca/dia. Assim, a adoção de inovações tecnológicas pode viabilizar o crescimento do desempenho produtivo da atividade no município e alinhar o produtor com princípios de sustentabilidade.

  • MARCOS ANTÔNIO SOUZA DOS SANTOS
  • A PECUÁRIA DE CORTE NA AMAZÔNIA BRASILEIRA: SISTEMAS DE PRODUÇÃO, MERCADO E AMBIENTE INSTITUCIONAL

  • Data: 07/03/2017
  • Mostrar Resumo
  • O trabalho avalia as características tecnológicas dos sistemas de produção, o mercado e o ambiente institucional da pecuária de corte na Amazônia. A tese é composta por quatro capítulos, elaborados a partir de dados oficiais sobre produção, mercados e políticas públicas de investimento, combinadas com a aplicação de métodos estatísticos e econométricos. No primeiro capítulo utilizam-se dois métodos estatísticos multivariados, inicialmente aplica-se análise fatorial para identificar os fatores tecnológicos subjacentes e, a partir dos escores fatoriais, calcula-se um índice para aferir o nível tecnológico dos sistemas de produção de bovinos nos municípios da Amazônia. Também foi utilizada análise de agrupamentos para identificar grupos homogêneos de municípios quanto ao nível de adoção de tecnologias. No segundo capítulo estima-se, a partir de métodos econométricos, uma função de produção do tipo Cobb-Douglas, com o objetivo de avaliar a eficiência econômica dos sistemas de produção de bovinos quanto ao uso dos fatores de produção (pastagens, trabalho e capital), além de identificar o efeito deslocamento causado pelo acesso aos serviços de assistência. O terceiro capítulo avalia o comportamento da produção, mercado e das mudanças no ambiente institucional da pecuária bovina nas últimas três décadas. O quarto capítulo avalia o mercado de bovinos a partir da estimação de um modelo econométrico recursivo de demanda e oferta. A finalidade é quantificar os efeitos de variáveis relevantes como preços, renda, salário rural, crédito rural, entre outras, sobre o comportamento da demanda e da oferta de bovinos para abate. Estes resultados são importantes para orientar os investimentos e as políticas públicas de fomento à pecuária de corte na Amazônia, numa perspectiva de inovação tecnológica e sustentabilidade.

  • DARLENA CAROLINE DA CRUZ CORREA
  • Avaliação de diferentes doses de nitrogênio sobre as características produtivas, morfogênicas, estruturais e nutricionais do capim Panicum maximum Jacq. cv. Mombaça

  • Data: 03/03/2017
  • Mostrar Resumo
  • Objetivamos com este estudo avaliar os efeitos de diferentes níveis de adubação nitrogenada no acúmulo de forragem e nas características morfogênicas, estruturais e nutricionais do capim Panicum maximum cv. Mombaça, no segundo ano de avaliações experimentais. O trabalho será conduzido na área experimental da Faculdade de Medicina Veterinária da Universidade Federal do Pará, município de Castanhal-PA. O delineamento experimental será o de blocos completos casualizados, com 6 tratamentos correspondendo a 6 doses de nitrogênio (0, 10, 20, 30, 40, 50 kg de N/ha/aplicação) e 4 repetições, totalizando 24 unidades experimentais (parcelas). Serão avaliadas as características de massa e acúmulo de forragem, matéria seca verde de lâminas foliares (MSVLF), matéria seca verde de colmo (MSVC), material morto (MM), matéria seca verde (MSV), matéria verde (MV), lâmina foliar (LF), colmo (CO), relação lâmina foliar/colmo - F:C, eficiência de colheita (EC) e densidade volumétrica da forragem acumulada. Nos perfilhos serão feitas as mensurações de: taxa de aparecimento foliar (TAPF) e filocrono, taxa de alongamento foliar (TALF), comprimento final da folha (CFF), taxa de alongamento de colmos (TALC) e comprimento médio do colmo (CMC), número de folhas verdes por perfilho (NFVp), número total de folhas (NTF), número de folhas vivas por perfilho (NFV), duração de vida da folha (DVF), número de folhas mortas (NFM) e taxa de senescência de folhas (TSF). Para determinação das características químico-bromatológicas se procederam as análises de matéria seca (MS), proteína bruta (PB) e as frações de proteína (A, B1, B2, B3 e C), matéria mineral (MM), extrato etéreo (EE), fibra em detergente neutro (FDN), fibra em detergente ácido (FDA), lignina, digestibilidade in vitro da matéria seca (DIVMS), carboidratos totais (CT), carboidratos não fibrosos (CNF) e as frações de carboidratos A, B1, B2 e C. As informações climáticas serão coletadas durante todo o período da pesquisa e os dados experimentais serão analisados submetendo-os à análise de regressão linear múltipla, adotando-se um nível de significância de 5% de probabilidade.

  • SARAH OLIVEIRA SOUSA PANTOJA
  • Consumo e digestibilidade em ovinos submetidos a dietas contendo óleo residual de fritura.

  • Data: 03/03/2017
  • Mostrar Resumo
  • O óleo residual de fritura (ORF) está entre os materiais que representam grandes riscos ao meio ambiente pelo seu alto poder poluente. O aproveitamento desse resíduo na alimentação de ovinos pode ser uma alternativa para minimizar impactos ambientais, aumentar a concentração energética das dietas e reduzir os custos de produção. A presente pesquisa teve por objetivo avaliar o efeito da inclusão ORF em dietas para ovinos, e determinar a concentração ideal de óleo na dieta. O experimento foi conduzido na Universidade Federal Rural da Amazônia - UFRA. Foram utilizados 25 cordeiros machos, inteiros, da raça Santa Inês. Os animais serão alimentados duas vezes e as dietas experimentais foram formuladas na proporção volumoso/concentrado de 50:50, sendo o volumoso composto por silagem de cana e concentrado a base de milho moído, farelo de soja, farelo de trigo, óleo de fritura residual, calcário calcítico e uréia. Foram avaliadas cinco concentrações de ORF, obtido de um microempresário que trabalha exclusivamente na venda de batatas fritas. O óleo integrou as dietas nas concentrações 0; 2; 4; 6 e 8% da matéria seca das dietas. O período experimental teve duração de 21 dias, sendo 14 dias para adaptação e sete dias para coleta total de fornecido, sobras e fezes. Foram determinados o consumo e a digestibilidade da Matéria Seca (MS), Matéria Orgânica (MO), Extrato Etéreo (EE), Proteína Bruta (PB), Fibra em Detergente Neutro (FDN) com correções dos teores de cinzas e proteína, e Fibra em Detergente Ácido (FDA). O delineamento utilizado foi em blocos casualizados, com cinco concentrações de ORF e cinco repetições por tratamento. Os resultados obtidos foram submetidos à análise de regressão polinomial através do procedimento REG do SAS (2008) para estimar os ajustes das curvas ao nível de 5% de probabilidade.

     

  • CAMILO ANDRES GONZALEZ GONZALEZ
  • Avaliação ultrassonográfica em modo B dos ossos apendiculares de aves rapinantes 

  • Data: 21/02/2017
  • Mostrar Resumo
  • Dentro da medicina de animais silvestres é frequente a ocorrência de lesões envolvendo o sistema musculoesquelético de aves de vida livre ou mantidas em cativeiro. Porém, a informação disponível em relação a diagnóstico e manejo clínico dos problemas ortopédicos das aves é ainda insuficiente para uma abordagem médica satisfatória levando muitas vezes à incapacidade ou morte do animal. A ultrassonografia é uma ferramenta diagnóstica que se caracteriza por ser rápida, repetível, não invasiva, livre de radiação ionizante e de fácil acesso em lugares remotos como a floresta. Contudo, as aplicações do ultrassom em aves são limitadas pelo sistema de sacos aéreos e o tamanho dos pacientes. O objetivo do presente estudo é descrever e padronizar o uso da ultrassonografia Tríplex Doppler na avaliação dos ossos apendiculares de aves, bem como demonstrar a possibilidade de avaliar o espaço intramedular dos ossos, visto que estes processos não têm sido reportados na literatura. O estudo será desenvolvido no hospital veterinário da Universidade Federal do Pará (UFPA), envolvendo casuísticas de aves atendidas, bem como carcaças que são armazenadas no hospital. Será utilizada uma maquina PHILIPS HDI-4000, munida de um transdutor linear de 5-12 MHz. Será utilizado o Tríplex Doppler composto pelo Modo B, Doppler colorido e Doppler de fluxo, o que permite avaliar a morfologia, topografia e ecogenicidade dos ossos, além da presença, direção e velocidade do fluxo sanguíneo. Os ossos a serem estudados são úmero, radio, ulna, fêmur, tíbiotarso e tarsometatarso das aves. Será realizada biometria óssea tanto pela ultrassonografia em modo B como com o auxilio de um paquímetro.

  • HIGO ANDRADE ABE
  • ESTRATÉGIA ALIMENTAR NA PRODUÇÃO DO CICLIDEO ORNAMENTAL AMAZÔNICO ACARÁ-SEVERO (HEROS SEVERUS HEKEL 1840): LARVICULTURA E ALEVINAGEM

  • Data: 17/02/2017
  • Mostrar Resumo
  • O Acará-severo(Heros severus) é uma espécie nativa da bacia amazônica que apresenta grande potencial para piscicultura ornamental, apresentando cores exuberantes além de um valor econômico atrativo no mercado de organismos aquáticos ornamentais. Entretanto há poucas informações científicas sobre as condições ideais de criação para a espécie desde reprodução, larvicultura, nutrição e manejos alimentares. Neste contexto um dos grandes entraves da produção em cativeiro de organismos aquáticos ornamentais é a falta de conhecimento sobre a exigência e manejo nutricional das espécies produzidas. Desta forma o presente trabalho teve como objetivo determinar as frequências e taxas de alimentação na larvicultura e alevinagem de Acará severo, além de estratégias de manejo alimentar a partir ciclos de privação alimentar. Os estudos foram divididos em três experimentos onde: o primeiro objetivou-se determinar a taxa e a frequência alimentar de larvas de H. severus, sendo que o experimento foi realizado em um esquema fatorial 4x2 com quatro taxas de alimentação 100, 150, 200, 250 náuplios de Artemia por larva dia) e duas frequências de alimentação (2 ou 4x ao dia) durante 15 dias (período de larvicultura); no segundo experimento foi avaliado o desempenho produtivo e higidez de alevinos de Acará-severo submetidos a ciclos de privação alimentar: 7/0 sete dias de alimentação e zero dias de privação; 6/1 seis dias de alimentação e um dia de privação; 5/2 cinco dias de alimentação e dois dias de privação e ALT alimentação em dias alternados, durante 90 dias;e no terceiro experimento foram avaliadas taxa e frequência de alimentação para alevinos de acará severo produzidos em sistemas de recirculação, constituindo-se em um experimento utilizando um esquema fatorial 3x2 com três taxas de alimentação (3, 6, 9%PV.dia-1) e duas frequências alimentares (2 ou 4 alimentações ao dia) durante 90 dias. Ao fim dos experimentos foi realizado a avaliação dos parâmetros zootécnicos e avaliação de higidez (experimentos 2 e 3) pela avaliação hematológica. Os resultados foram submetidos ao teste de Tukey a 5%. Os resultados apontaram que larvas de Acará-severo devem ser alimentadas com 250 náuplios de Artemia divididos em quatro alimentações diárias. Na alevinagem os peixes desta espécie podem ser submetidos a privação alimentar de 1 dia promovendo economia de 10% de ração e 14%na mão de obra, sem que afete desempenho produtivo, o grau de higidez e a sobrevivência dos peixes. A melhor taxa de alimentação para alevinos é de 6% da biomassa e pode ser fornecida duas vezes ao dia sem comprometer índices zootécnicos e hematológicos.

  • JOEL ARTUR RODRIGUES DIAS
  • Bactéria probiótica durante a recria de juvenis de Colossoma macropomum Cuvier, 1818: Seleção, desempenho zootécnico e desafio sanitário.

  • Data: 17/02/2017
  • Mostrar Resumo
  • Com este trabalho objetivou-se selecionar cepas com potencial uso probiótico, espécie-específico, e avaliar os efeitos de sua suplementação dietética no desempenho zootécnico e aspectos sanitários de Colossoma macropomum desafiados com Aeromonas hydrophila. Para tanto, a avaliação in vitro de isolamento e seleção de cepas com potencial uso probiótico foi determinada frente à resistência aos fatores bioquímicos, resistência a ação dos sais biliares (5% p/v), teste de antagonismos à patógenos assim como avaliar o tempo de manutenção da cepa incluída na ração. As cepas foram identificadas geneticamente. Como produto das análises in vitro a cepa que apontou maior potencialidade foi identificada como Bacillus cereus, que seguiu à avaliação para suplementação dietética avaliando os parâmetros de desempenho zootécnico, as bactérias foram incluídas na ração a 32% de proteína bruta, em um delineamento inteiramente casualizado, constituídos de três tratamentos, 3,8 x 104, 3,8 x 106 e 3,8 x 108 UFC.g-1 de ração, mais um controle sem a inclusão do probiótico, com cinco repetições, utilizando um sistema de recirculação de água com 20 tanque de 150 L, filtro biológico e UV, a biomassa inicial foi de aproximadamente 19,77±0,6g, com 20 indivíduos em cada tanque. A cada 30 dias foram realizadas biometrias periódicas para o reajuste de ração e avaliação aos parâmetros de ganho de peso, comprimento e altura, taxa de crescimento específico, sobrevivência, conversão alimentar aparente e fator de condição de Fulton, durante 120 dias experimentais. O ultimo experimento avaliou a suplementação probiótica frente ao desafio sanitário com bactéria patogênica Aeromonas hydrophila após 120 dias de alimentação com a inclusão do probiótico, para tanto utilizou-se um (DIC), constituído dos peixes alimentados com ração probiótica e infectados com a dose sub-letal do patógeno, 2,7 x 106 UFC.g-1 de peixe, e mais dois controles, com e sem infecção ao patógeno, utilizando aquários de 60 L em sistema semiestático de aeração constante, com três repetições. O uso de B. cereus com finalidades probiótica, apontou para melhorias aos parâmetros de desempenho zootécnico ao tambaqui, assim como proporcionou melhores respostas inatas na avaliação hematológica da espécie desafiada com Aeromonas hydrophila.

  • LETICIA GODINHO ATHAIDE
  • RESPOSTAS TERMORREGULADORAS E DE COMPORTAMENTO DE BÚFALAS, EM PLENO SOL E EM CONDIÇÕES DE SOMBREAMENTO, EM ANO DE EL NIÑO FORTE NA ILHA DE MARAJÓ, PARÁ, BRASIL.

  • Data: 01/02/2017
  • Mostrar Resumo
  • O trabalho visou avaliar respostas termorreguladoras, comportamentais e uso de termografia infravermelha, indicadoras de estresse térmico em búfalas criadas ao sol e à sombra, nas condições climáticas de Cachoeira do Arari, ilha de Marajó, Pará (00°55’37”S e 48°43’48”W),entre outubro e novembro (período seco) de 2015. Foram utilizadas 20 búfalas Murrah, entre dois e três anos de idade e com peso médiode 267,92 ± 28 kg, cíclicas, não-gestantes e não-lactantes, clinicamente saudáveis, e distribuídas aleatoriamente em dois grupos (grupo CS - com sombra e grupo SS - sem sombra), em pastejo contínuo, com acesso à água para beber e sal mineral ad libitum. Foram obtidos dados de temperatura do ar (TA, ºC),umidade relativa do ar (UR, %) e velocidade do vento (VV, m/s).No experimento 1foram avaliadas reações termorreguladoras de búfalas, na presença ou ausência de radiação solar direta, eregistrados dados de temperatura retal (TR), frequência respiratória (FR) e temperatura da superfície corporal (TSC), às6h, 10h, 14h, 18h e 22h. O experimento foi inteiramente casualizado, com delineamento de intercâmbio “crossover”. A análise da termografia infravermelho foi realizada com câmera FLIR T - series T640bx.No experimento 2foi avaliado o comportamento das búfalas, em dois diferentes sistemas de criação, pastagem sem sombra e com sombra, em sistema silvipastoril. A campanha de colheita de dados ocorreu no período seco, em quatro categorias de atividades: pastejo, ruminação, ócio e outras atividades, de forma contínua, visando observação representativa dessas atividades, a cada cinco minutos, com comparação das médias (Tukey a 5%) das variáveis climáticas e de comportamento para medir o efeito do tratamento, turnos e períodos do ano.

  • HERNANDO ANDRES MUNOZ CARRILLO
  • Levantamento sorológico para Brucelose, Paratuberculose, Leucose Enzoótica Bovina e Diarreia Viral Bovina em bovinos destinados à exportação

  • Data: 17/01/2017
  • Mostrar Resumo
  • A exportação de bovinos vivos é uma das novas áreas comerciais em que o Brasil está inserido, porém é necessário que os animais sejam livres de certas doenças infectocontagiosas, principalmente as exigidas pelos países importadores. Os 1800 soros utilizados neste estudo são de bovinos dos Estados de Goiás (GO), Minas Gerais (MG) e São Paulo (SP), que seriam destinados à exportação. Foram realizados os diagnósticos sorológicos para brucelose bovina (BB), paratuberculose (PTB), leucose enzoótica bovina (BEL) e diarreia viral bovina (BVD). A porcentagem total de animais positivos para cada uma das patologias foi de 0,33% (2/1800) para BB; 16,17% (97/1800) para PTB; 31,50% (189/ 1800) para EBL e 9,67% (58/1800) para BVD. 

2016
Descrição
  • ALESSANDRA XIMENES SANTOS
  •  AVALIAÇÃO DO USO DA L-ARGININA E DA CICLODEXTRINA COMO AGENTES DA CAPACITAÇÃO ESPERMÁTICA NO PROCESSO DE PRODUÇÃO IN VITRO DE EMBRIÕES BUBALINO

  • Orientador : OTAVIO MITIO OHASHI
  • Data: 21/12/2016
  • Mostrar Resumo
  • A elaboração de meios adequados e específicos para o processo de capacitação espermática, bem como, para o cultivo dos gametas e embriões pode alavancar a eficiência das biotécnicas da reprodução na espécie bubalina. A L-arginina (LA) e a metil β-ciclodextrina (MBCD) tem mostrado resultados promissores ao melhorar a motilidade e induzir a capacitação espermática em varias espécies, no entanto seus efeitos sobre o desenvolvimento do embrionário são poucos conhecidos.  Assim, nossa hipótese é que o uso dessas substâncias como agentes indutores de capacitação como podem melhorar a taxa de fecundação e formação de embriões bubalinos. Para isso, foram avaliados o uso da LA e da MBCD(0,5mM, 0,75mM e 1,5 mM) e heparina como agentes no processo de capacitação espermática e na produção in vitro de embriões bubalinos, através das taxas de exocitose acrossomal, viabilidade espermática, potencial de membrana mitocondrial e fosforilação resíduos de tirosina nos diferentes períodos de incubação (0, 3 e 6 horas) de pré-capacitação. Foram utilizados os fluorocromos, como o isotiocianato de fluoresceína conjugado lectina Pisum sativum (PSA-FITC), o iodeto de 5,5', 6,6'-tetracloro-1,1',3,3'-tetraetilbenzimidazolilcarbocianina (JC-1) e o iodeto de propídio (PI) através da citometria de fluxo. Para analise do estado de fosforilação de resíduos de tirosina o anticorpo anti-fosfotirosina monoclonal conjugado com Alexa Fluor 488 em microscopia de epifluorescência. Além disso, foi determinado também o efeito dos agentes capacitantes na produção in vitro de embriões bubalinos. Nos períodos de 3 e 6 horas de incubação a taxa de lesão de membrana plasmática e acrossomal  foi  maior na concentração 1,5mM de MCBD quando comparado aos demais grupos (0,5mM, 0,75mM) heparina, L-arginina e controle (p<0.05). Quanto ao potencial de membrana mitocondrial as taxas foram semelhantes entre os grupos, porém  houve diminuição do potencial a partir de 3 horas.  Quanto a fosforilação dos resíduos de tirosina houve aumento gradativo a partir de 3 horas, mas não houve diferença entre grupos e entre os períodos de 3 e 6 horas (p>0.05). Já em relação, a produção in vitro de embriões bubalinos à taxas de clivagem e blastocistos foram semelhantes nos  grupos  heparina e CBDM. Porém, não foi observada formação de embriões nos grupos controle negativo e LA. O uso de MBCD na diferentes concentrações apresentaram resultados semelhantes ao controle positivo, demonstrando que MBCD pode ser utilizada como um substituto da heparina.

  • VITOR HUGO MAUES MACEDO
  • Produção de forragem e respostas morfofisiológicas de Panicum maximum cv. Tanzânia sob diferentes frenquêcias de desflhação

  • Data: 09/12/2016
  • Mostrar Resumo
  • Com o crescimento dos rebanhos e consequente intensificação dos sistemas de produção, a atividade pecuária exige maior produtividade sobretudo em sistemas de pastagens que proporcionem bom desempenho animal e que possam agregar valor ao produto final com baixo custo de produção. O manejo adequado das pastagens e do sistema de pastejo na propriedade com a correta determinação da entrada e saída dos animais é uma alternativa interessante para aumentar a produtividade animal dentro do sistema de produção, bem como, na redução dos custos. O capim Panicum maximum cv. Tanzânia é uma espécie forrageira de alto valor nutritivo e de grande potencial na utilização de sistemas de produção animal a pasto, sobretudo na produção de ovinos, porém com poucos resultados de pesquisa quanto a sua utilização na região note. O presente projeto tem por objetivo avaliar a produção de forragem por meio do acumulo de biomassa, o índice de área foliar, interceptação luminosa, composição morfológica, altura do dossel, morfogênese, densidade populacional de perfilhos e padrão demográficos de perfilhos do capim Panicum maximum cv.Tanzânia, submetidos a diferentes frequências de desfolhação, assim como determinar o melhor momento de realizar a desfolha por corte mecânico com o intuito de realizar futuras recomendações quanto ao manejo desta espécie em sistemas de produção animal a pasto e experimentos de animais em pastejo ao longo do ano no nordeste paraense.

  • FERNANDO BARBOSA TAVARES
  • EMULSIFICANTE (LECITINA DE SOJA E POLIETILENO GLYCOL RICINOLEATO) NA DIETA PARA FRANGOS DE CORTE
  • Data: 04/11/2016
  • Mostrar Resumo
  • O aproveitamento das frações lipídicas nas dietas, pode ser potencializado com emulsionantes exógenos. Objetivou-se assim avaliar a influencia de diferentes fontes lipídicas na metabolizabilidade de nutrientes e dos perfis sérico de frangos de corte, com a inclusão de emulsificante (polietileno glicol ricinoleato e lecitina de soja). Foram alojados 500 pintos machos de corte, Cobb, distribuídos em um arranjo fatorial 4x3, com oito repetições, com 4 fontes lipídicas, cito: Óleo de Soja, Óleo de Aves, Óleo de Peixe e Sebo Bovino; e 2 inclusões, sendo uma sem inclusão do produto, e outra com a inclusão do emulsificante ao nível e 0,05%. Aos 18 dias de idade foram iniciados os ensaios de metabolismo. Procedeu-se as análises de matéria seca, proteína, extrato etéreo, energia bruta e baseados no consumo e produção de excretas, determinou-se a energia metabolizável aparente (EMA) e aparente corrigida (EMAn). Ao final do período de coleta de excretas foram coletadas amostras de sangue  para determinação dos teores de lipoproteína de alta densidade (HDL), lipoproteína de baixa densidade (LDL), triacilglicerol (TG) e colesterol (CO). Os dados obtidos foram submetidos a analise de variância no SAS e as médias comparadas pelo teste de Tukey, a significância de p<0.005. Não observou-se diferença para o consumo de ração, coeficiente de metabolizabilidade da matéria seca e proteína bruta. Observou-se efeito significativo quanto a fonte lipídica testada para a energia, o óleo de soja obteve maiores valores quando comparado ao óleo de peixe, estes não diferindo dos demais. O coeficiente de metabolizabilidade do extrato etéreo (CMEE), foi menor nas dietas do sebo (p<0.0001). A fonte lipídica modifica a metabolizabilidade de dietas. O emulsificante (polietileno glicol ricinoleato e lecitina de soja) nos valores testados não modifica a metabolizabilidade de ingredientes e não modifica os parâmetros séricos de HDL, LDL, Colesterol e Triacilglerol.

  • HENRY DANIEL MANRIQUE AYALA
  • Estudo anatomopatológico, imunohistoquímico e molecular da infecção natural por Brucella Abortus em búfalas (Bubalus bubalis)

  • Data: 16/09/2016
  • Mostrar Resumo
  • A brucelose é uma doença antiga com mecanismos evolucionados que permitem manipular a imunidade celular e resistir a respostas celulares imunes, conseguindo assim persistência intracelular. Constituí uma importante doença zoonótica responsável por consideráveis perdas econômicas em animais de produção. O objetivo deste estudo é descrever as alterações histológicas uterinas de vacas bubalinas naturalmente infectadas com Brucella abortus e comparar estas alterações com os resultados imunohistoquímicos e detectar o agente pela reação em cadeia mediada pela polimerase (PCR). Foram colhidas amostras de 19 bufalas reagentes ao antígeno acidificado tamponado (AAT) e fixação de complemento (FC). Para o controle negativo foi selecionado um animal não reagente a (FC). Para os controles positivos foram representados por linfonodos de dois casos, com (PCR) positivos à B. abortus. A colheita foi realizada na linha de abate num frigorifico do município de Castanhal-PA, registrado e fiscalizado pelo Serviço de Inspeção Estadual (SIE) da Agência de Defesa Agropecuária de Estado do Pará (ADEPARÁ), os úteros foram acondicionados em caixa de polímero expandido contendo gelo e encaminhadas ao Laboratório de Patologia Animal (LABOPAT) do Instituto da Saúde e Produção Animal da Universidade Federal Rural da Amazônia (ISPA-UFRA). As amostras foram avaliadas macroscopicamente para a histopatologia e imunohistoquimica amostras de linfonodo perivaginal e útero foram fixadas em formol tamponado a 10%, por um período superior a 48 horas e processadas rotineiramente para a coloração pela hematoxilina - eosina. A análise imunohistoquímica foi feita no Instituto Evandro Chagas onde  os cortes em lâminas positivadas foram incubadas com um anti-soro monoclonal de coelho contra o B. abortus na diluição de 1:200, incubadas pelo complexo streptavidina-biotina (LSAB) com o anticorpo secundário biotinilado universal; para a revelação das reações foi utilizado o cromógeno diaminobenzidina (DAB). As Reações em Cadeia da Polimerase (PCR) foram realizadas no Laboratório de Tecnologia Biologia Molecular da Universidade Federal do Pará (LTB-UFPA), foi realizada a extração de DNA pelo método Proteinase K e Guanidina, modificado, de acordo com o protocolo de (BIASE et al., 2002). Utilizando as sequências do primer Forward (GAGAATAAAGCCAACACCCG) e Reserve (GATGGACGAAACCCACGAAT) para amplificar uma sequência de 317 pb (pares de bases) que inclui a região IS711 do genoma da Brucella. Nos resultados de IHQ foram achadas imunomarcação no linfonodo perivaginal e útero de 75% (15) e 25% (5) respetivamente assim com os que não imunomarcaram 25% (5) e 75% (15) (P=0,0017). Na detecção do agente por PCR segundo o local linfonodo perivaginal, muco uterino e útero foram achados valores de 47,0% (8)b, 82,3% (14)a, 29,4% (5)b (P<0,002). Os dados foram processados em planilhas eletrônicas e submetidos ao programa estatístico SAS (2009), onde as frequências foram submetidas ao teste estatístico de Fisher.

  • BRUNO JOSE CORECHA FERNANDES EIRAS
  • EFEITO DA SALINIDADE E DA FREQUÊNCIA ALIMENTAR SOBRE A LARVICULTURA DOS ORNAMENTAIS AMAZÔNICOS ACARÁ BANDEIRA Pterophyllum scalare (SCHULTZE, 1823) E ACARÁ SEVERO Heros severus (HECKEL, 1840)

  • Data: 21/07/2016
  • Mostrar Resumo
  • Com o estudo objetivou-se avaliar o efeito da salinidade e da frequência de alimentação no crescimento, uniformidade e sobrevivência de pós-larvas de acará-bandeira Pterophyllum scalare e acará-severo Heros severus. Foram realizados dois experimentos em delineamento experimental inteiramente casualizado em esquema fatorial 5 x 2, com cinco diferentes concentrações de cloreto de sódio (0; 2; 4; 6 e 8 g L-1), duas frequências alimentares (2 e 4 vezes ao dia) e quatro repetições. Foi observado que a salinidade da água e a frequência alimentar influenciaram significativamente (p < 0,05) no comprimento do tronco e altura do corpo de larvas de acará-bandeira. O diâmetro do olho foi influenciado (p < 0,05) apenas pela salinidade, enquanto que o comprimento padrão final, ganho de comprimento padrão, comprimento da cabeça, comprimento do tronco, comprimento pós-anal, altura da cabeça, altura do corpo, peso final, ganho de peso, taxa de crescimento específico e fator de condição alométrico diferiram significativamente (p < 0,05) pela frequência de alimentação. Na larvicultura do acará-severo, houve diferença significativa (p < 0,05) no comprimento da cabeça, comprimento pós-anal, altura da cabeça e fator de condição alométrico pela salinidade e frequência alimentar. A salinidade da água influenciou significativamente (p < 0,05) o comprimento padrão final, ganho de comprimento padrão, comprimento do tronco, diâmetro do olho, altura do corpo, taxa de sobrevivência e uniformidade em peso. A frequência alimentar influenciou significativamente (p < 0,05) o peso final, ganho de peso e taxa de crescimento específico. Concluiu-se que as pós-larvas de acará-bandeira podem ser cultivadas com salinidade de até 4 g L-1 sem problemas ao desenvolvimento e sobrevivência. Por outro lado, as pós-larvas de acará-severo obtiveram melhor taxa de sobrevivência em água sem adição de sal. A frequência alimentar de quatro vezes ao dia com náuplios de Artemia é a mais recomendada para ambas as espécies.

  • JONATHAN ALVES DE SOUSA
  •  Exigência de proteína bruta na dieta de alevinos e juvenis do ornamental amazônico acará severo Heros severus

  • Data: 21/07/2016
  • Mostrar Resumo
  • Realizaram-se dois experimentos com o objetivo de determinar a exigência de proteína bruta (PB) na dieta de alevinos e juvenis de acará severo (Heros severus). Em ambos os experimentos testaram-se cinco dietas isoenergéticas (3.200 kcal de ED/ kg) contendo cinco níveis de PB (28, 32, 36, 40 e 44%). Nos experimentos, 75 alevinos e 100 juvenis foram distribuídos em 15 e 20 aquários com volume útil de 30L e 50L, respectivamente, em um delineamento experimental inteiramente casualizado com cinco tratamentos e três e quatro repetições, respectivamente, sendo o aquário a unidade experimental. Durante 105 dias, os alevinos e juvenis foram alimentados a uma taxa de 10 e 3% do peso vivo, três e duas vezes ao dia, respectivamente. Não houve efeito significativo dos níveis de PB da dieta sobre a sobrevivência, índice hepatossomático, viscerossomático e teor de umidade corporal para os alevinos (P>0,05). Ocorreu efeito quadrático do ganho de peso e comprimento, taxa de crescimento específico, consumo de ração diário e conversão alimentar com o aumento dos níveis de proteína bruta da dieta (P<0,05), estimando-se valores de 41,86; 40,42, 41,29; 39,60; 43,54 % de PB, respectivamente. Houve decréscimo linear da taxa de eficiência proteica de alevinos com os níveis crescentes de proteína bruta da dieta (P<0,05). Ocorreu efeito quadrático da proteína corporal, lipídeo corporal e cinzas, com o aumento dos níveis de proteína bruta da dieta, estimando-se valores de 40,64; 37,77 e 37,50% de PB, respectivamente. Não houve efeito significativo dos níveis de proteína da dieta sobre a sobrevivência de juvenis (P>0,05). Foi observado efeito quadrático do ganho de peso, taxa de crescimento específico, conversão alimentar, taxa de eficiência proteica e índice hepatossomático de juvenis (P<0,05), estimando-se valores de 37,03; 37,20; 35,13; 35,85; 38,78% de PB, respectivamente. O consumo de ração apresentou aumento linear (P<0,05) com o aumento dos níveis de proteína da dieta. Houve um decréscimo linear (P<0,05) do índice viscerossomático com os níveis crescentes de proteína da dieta. A glicemia e o hematócrito apresentaram menores valores (P<0,05) nos peixes que receberam dieta com o menor teor de proteína. Com base no desempenho, eficiência de utilização dos nutrientes e índices de condição corporal de alevinos e juvenis de acará severo, estima-se os níveis de 37,77 a 43,54% e 34,74 a 38,78 % de PB, respectivamente.

     

  • ADRIANA XAVIER ALVES
  • EFEITOS DE DIETAS SUPLEMENTADAS COM VITAMINA E SOBRE O CRESCIMENTO, EFICIÊNCIA ALIMENTAR E PARÂMETROS HEMATOLÓGICOS E FISIOLÓGICOS DO TAMBAQUI Colossoma macropomum (CUVIER, 1818)

  • Data: 20/07/2016
  • Mostrar Resumo
  • Com o presente trabalho objetiovou-se avaliar o efeito de diferentes níveis de vitamina E (acetato de DL-α-tocoferol, 50% ativo) sobre o crescimento, sobrevivência, eficiência alimentar e parâmetros hematológicos e fisiológicos em alevinos de Tambaqui (Colossoma macropomum). Um total de 150 peixes com média inicial de peso de 2,94 ± 0,14 g e comprimento padrão de 4,29 ± 0,07 cm foram dispostos em caixas de fibra de vidro (300L), sistema de recirculação, temperatura de 27 °C e pH, 7,0. A densidade de estocagem foi de 10 peixes por unidade experimental. Assim, foi utilizado um delineamento inteiramente casualizado com três repetições e cinco tratamentos, denominados pelos níves de inclusão do α-tocoferol na dieta: 0 (controle), 250, 500, 700 e 1000 mg kg-1. Os peixes foram alimentados três vezes ao dia durante 12 semanas. Os resultados indicam que os diferentes níveis de vitamina E não influenciaram a sobrevivência, o desempenho, os índices de rendimento e a eficiência alimentar dos alevinos de tambaqui. Porém, a inclusão de 1000 mg kg-1 de α-tocoferol reduziu (P<0,05) a quantidade de glicose para 80,4 ± 1,85 mg dL-1 em comparação aos tratamentos suplementados com 0 e com 250 mg kg-1 que apresentaram 117,3 ± 9,59 e 126,77 ± 18,94 mg dL-1 de glicose, respectivamente. O hematócrito, a proteína total, o número de eritrócitos, o volume corpuscular médio, a hemoglobina corpuscular média e a concentração de hemoglobina corpuscular média dos alevinos de tambaqui não foram influenciados (P>0,05) pela suplementação. Na contagem diferencial de leucócitos, não houve diferença significativa no número de linfócitos, monócitos e basófilos. Contudo, a quantidade de neutrófilos foi maior no tratamento controle (P<0,05), enquanto o número de eosinófilos e células granulocíticas especiais foi maior nos tratamentos com 700 mg kg-1 e 250 mg kg-1 de α-tocoferol, respectivamente. Apesar da suplementação com vitamina E na dieta não ter influenciado o desempenho de alevinos de tambaqui, a dieta isenta de vitamina E promoveu aumento do número de neutrófilos, demonstrando maior susceptibilidades destes peixes aos processos inflamatórios. Além disso, com base na glicemia, alevinos de tambaqui alimentados com altas concentrações de vitamina E, podem apresentar melhoras na resistência em condições de estresse.

  • BRUNO CESAR BRITO DIAS
  • UTILIZAÇÃO DO EUGENOL COMO ANESTÉSICO PARA O CARÁ SEVERO Heros severus (Heckel, 1840).

  • Data: 20/07/2016
  • Mostrar Resumo
  • A utilização de anestésicos na piscicultura para realização de procedimentos de manejo é normalmente justificada como necessária para a redução do estresse causado por esses procedimentos. No entanto, trabalhos recentes mostram que as respostas fisiológicas características do estresse, continuam acontecendo, mesmo após os peixes alcançarem o estágio de anestesia profunda. Desta forma, foram realizados dois diferentes trabalhos, utilizando o eugenol como anestésico para o acará severo Heros severus. Ambos os trabalhos foram realizados no Laboratório de Peixes Ornamentais da Faculdade de Engenharia de Pesca do Instituto de Estudos Costeiros da Universidade Federal do Pará, Campus de Bragança. No primeiro trabalho, objetivou-se analisar a eficiência do eugenol como anestésico para duas classes de tamanho, alevino e adultos do acará severo e verificar qual a dose mais eficiente no tempo de indução e recuperação à anestesia. Para realização do primeiro trabalho foram utilizados 120 indivíduos de H. severus, alevinos (n=60) com 0,07 ± 0,01g e 1,3 ± 0,29 cm e adultos (n=60) com 25,2 ± 0,86g e 8,2 ± 0,12 cm. Os alevinos foram selecionados em tamanhos homogêneos e transferidos aleatoriamente para seis aquários de 60 L em uma densidade de estocagem de 10 exemplares por aquário. Da mesma forma, os adultos, foram selecionados aleatoriamente e transferidos em tamanhos homogêneos para seis aquários de 200L, também em densidade de estocagem de 10 exemplares por aquário. Após novo período de aclimatação, realizou-se os experimentos em um delineamento inteiramente casualizado com seis tratamentos, ou seja, concentrações de eugenol (50; 75; 100; 125; 150 e 175 mgL-1 ) e 10 repetições, sendo o peixe a unidade experimental. Com base nos resultados encontrados recomenda-se para os alevinos a concentração de 50 mg L-1, para realização de manejos de curta e de longa duração e para os adultos, recomenda-se a concentração de 50 mg L-1 para procedimentos de curta duração e 75 mgL-1 para procedimentos de longa duração. Com o segundo trabalho objetivou-se avaliar as respostas fisiológicas de adultos de acará severo anestesiados com a concentração ideal do eugenol encontrada no experimento anterior. Para realização do ensaio foi utilizado um total de 60 peixes com peso e comprimento médio de 25,2 ±0,86g e 8,2 ± 0,12cm, respectivamente. Por um período de 15 dias, os peixes foram dispostos de maneira individual em 60 aquários de 60L contendo 45L de água. Para realização do trabalho utilizou-se um delineamento inteiramente casualizado em esquema fatorial 3 x 4, com cinco repetições, sendo o peixe a unidade experimental. Para verificar a ocorrência da influência do eugenol sobre os parâmetros fisiológicos e hematológicos do acará severo, coletou-se sangue dos peixes submetidos a três diferentes protocolos de procedimentos: anestesiado (peixes expostos a 75 mgL-1 de eugenol durante 133s); anestesia simulada (peixes submetidos a uma simulação do banho anestésico, também por 133 s, somente com água  e sem adição do anestésico); e controle (peixes mantidos no aquário sem manuseio e exposição ao anestésico). Para cada procedimento, foram realizadas quatro amostragens de sangue em diferentes tempos: 0 (imediatamente após o procedimento), 6, 12 e 24h. A retirada da amostra sanguínea foi feita por punção do vaso caudal, com o auxílio de agulhas e seringas de 1ml previamente umedecidas com EDTA a 10%. Em seguida procedeu-se com a realização das seguintes analises: glicose, hematócrito (Ht), proteína total (Pt), hemoglobina (Hb), número de eritrócitos (Er), volume corpuscular médio (VCM), hemoglobina corpuscular média (HCM), concentração de hemoglobina corpuscular média (CHCM), triglicerídeos (TGR) e Colesterol (COL). A exposição de adultos de acará severo a anestesia com eugenol na concentração ideal de 75 mgL-1 por 133 segundos, foi suficiente para causar alterações nos valores das variáveis, glicose, Ht, Pt, Hb, Er, VCM, HCM, CHCM, COL e TRI. Os resultados obtidos com os dois trabalhos mostram que o eugenol foi eficiente em  induzir alevinos e adultos de acará severo ao estagio estágio de anestesia profunda em todas as concentrações testadas e a concentração considerada ideal para anestesia dos adultos foi suficiente para causar alterações nas variáveis analisadas, desencadeando respostas fisiológicas características do estresse.

  • LILIAN KATIA XIMENES SILVA
  • Qualidade seminal de touros bubalinos (Bubalus bubalis) e sua relação com fatores ambientais e nutricionais

  • Data: 17/06/2016
  • Mostrar Resumo
  • Objetivou-se avaliar a relação existente entre a qualidade seminal de touros bubalinos (Bubalus bubalis) e fatores ambientais e nutricionais. Foram utilizados onze (11) touros bubalinos (Murrah), submetidos a dois ensaios experimentais, realizados em região de clima tropical úmido (Afi de Köppen). O primeiro ensaio foi dividido em três períodos experimentais (mais chuvoso, de transição e menos chuvoso), e compreendeu a avaliação da frequência respiratória (FR; mov/min), frequência cardíaca (FC; bat/min), temperatura retal (TR; ºC), temperatura de globo ocular (TGO; °C) e temperaturas de superfície escrotal (TSE; °C), nos turnos da manhã e da tarde. Foram realizadas colheitas e avaliação seminal quinzenais. Além do cálculo do Índice de Temperatura e Umidade (ITU) e do Índice de Conforto de Benezra (ICB). Os touros bubalinos apresentaram termogramas normais, não sendo constatadas alterações na termorregulação testículo-escrotal e na qualidade seminal. No segundo ensaio os animais foram distribuídos em três grupos experimentais (OPB - Óleo de Palma Bruto; RRP - Resíduo Graxo do Refino de Palma; CONT - Grupo Controle), sendo avaliado o efeito da suplementação lipídica na qualidade do sêmen.  A cada 15 dias, foram realizadas colheitas de sêmen, sendo o in natura submetido à avaliação de volume (VOL; mL), turbilhonamento (TURB; 0 a 5), motilidade espermática progressiva (MP; %), vigor (VIG; 1 a 5), concentração espermática (CONC; x109/mL), defeitos maiores (DMA; %), defeitos menores (DME; %), defeitos totais (DT; %) e integridade de membrana plasmática (IMP, %) através da coloração eosina-nigrosina (EN), e o criopreservado avaliado a MP, VIG, DMA, DME e DT, além da IMP, integridade acrossomal e potencial mitocondrial através de sondas fluorescentes. Além, da análise do perfil lipídico do plasma seminal e membrana plasmática espermática in natura. Os coprodutos agroindustriais, óleo de palma bruto e resíduo graxo do refino de palma podem ser utilizados na alimentação de touros bubalinos em centrais de inseminação artificial, causando efeitos positivos na qualidade do sêmen criopreservado.
  • HIGO GREGÓRIO SILVA FAVACHO
  • Diagnostico investigativo anato-histopatologico e molecular de patologias de bufalos no estado do Pará e Amapá

  • Data: 06/05/2016
  • Mostrar Resumo
  • Foram estudados 392 pares de testiculos, 92 eram patologicos entre as patologias, a mais prevalente foram as adrencias, orquites turbecolussas e degeneração testicular.

  • FABRICIO MENEZES RAMOS
  • MANUTENÇÃO E REPRODUÇÃO DO ACARI ZEBRA, Hypancistrus zebra (ISBRÜCKER & NIJISSEN, 1991) (PISCES, SILURIFORMES, LORICARIIDAE), EM LABORATÓRIO

  • Data: 29/04/2016
  • Mostrar Resumo
  • O presente trabalho objetivou o desenvolvimento de protocolos de manutenção e reprodução para a espécie acari zebra, Hypancistrus zebra. Primeiramente foi realizado um estudo prospectivo para avaliação da importância tanto ambiental quanto econômica do peixe zebra sendo então elaborada uma lista de espécies de peixes ornamentais prioritária do rio Xingu para desenvolvimento de tecnologias considerando a demanda de mercado, valor de comercialização, aspectos zootécnicos da espécie e tecnologia de produção disponível. Após essa etapa, quatro experimentos foram conduzidos em laboratório para avaliação de protocolos de criação em cativeiro. Para tanto, foram obtidos 300 exemplares de acari zebra sob a licença de número 38215-2. Os animais passaram por um período de quarentena onde foram aclimatados e mantidos em aquários no laboratório do consórcio Norte Energia. O primeiro experimento avaliou diferentes tipos de abrigo, confeccionados com pedras, tijolo e cano (PCV), para tanto foi utilizado câmeras filmadoras, sendo registrado, tanto o tempo, quanto a presença ou ausência dos animais nos abrigos e o tempo que permanecem fora deles; O segundo experimento foi relacionado a manutenção de animais com diferentes alimentos, sendo testados: Alimentos de origem animal como Artemia salina (Artemia sp.), camarão (Litopenaeus vannamei), mexilhão (Perna perna) e peixe (Cynoscion spp). Foi utilizado também para esse experimento, câmera filmadora onde foi registrado o tempo de procura e permanência de alimentação em cada item testado; No terceiro experimento foram avaliados diferentes protocolos de reprodução: -desova natural com indução hormonal, visando determinar o hormônio ideal e seus níveis mais adequados; -desova natural com indução natural com diferentes níveis de pH, visando determinar as melhores condições para a desova natural em aquários; reprodução natural através de grupos reprodutivos com diferentes proporções sexuais. O quarto experimento avaliou-se os protocolos de manutenção de larvas e juvenis de acaris zebras, para tanto foram avaliadas diferentes taxas e frequências alimentares assim como diferentes densidades estocagem. Como resultados, observou-se que de acordo com os critérios de seleção, o acari zebra é a espécie prioritária na familia loricariidae seguido por Hypancistrus sp2, Baryancistrus xanthelus, Scobinancistrus sp3 e Ancistrus sp4. Na família Potamotrygonidae é a Potamotrygon leopoldi. E na família Cichlidae as espécies Creniciclha regani e Teleociclha spp; O acari zebra tem maior preferência por abrigos confeccionados com argila (tijolo), desta forma pode ser confeccionado com formato e tamanho adequado ao bem estar da espécie. A artemia salina (Artemia sp.) é o alimento preferido do acari zebra e proporcionou maiores valores de ganho de peso e taxa de crescimento específico. A reprodução artificial com uso de hormônios e diferentes pH, precisa ser melhor estudada em acari zebra. Na reprodução natural a utilização 01 macho e 02 fêmeas por aquário produz melhor resultado. Em relação as taxas e frequência alimentar os resultados mostraram que não há diferença significativa entre as variáveis e devem ser alimentados com artemias adultas congeladas 2 vezes ao dia com 10% do seu peso vivo, e podem ser criados em todas as densidades avaliadas de 0,25, 0,50, 1,00 e 2,00 g L-1 dependendo da intenção do criador sem que aja diferença significativa no desempenho, no entanto maiores densidades devem ser analisadas a fim de se determinar uma densidade ideal para o cultivo da espécie.

  • PAULA FABRINY MAUÉS DA SILVA
  • TORTA DE COCO COMO FONTE PROTEICA PARA ALIMENTAÇÃO DE OVINOS

  • Data: 30/03/2016
  • Mostrar Resumo
  • O farelo de coco é uma alternativa para nutrição de ruminantes, pois além de reduzir os custos com a alimentação, possui perfil bromatológico fibroso, proteico e energético. Objetivo-se avaliar o consumo e a digestibilidade aparente do farelo de coco em níveis crescentes nas dietas a base de Capim Elefante (Pennisetum purpureum) em ovinos mestiços Santa Inês. Foram acompanhados 24 ovinos machos, inteiros, com idade média de 5 meses e peso aproximado 22,48Kg. As dietas experimentais consistiram em três níveis de inclusão do farelo de coco (FC) na fração concentrada da dieta (0, 25 e 50%), obedecendo a relação volumoso:concentrado de 30:70%. O farelo de coco adicionado a dieta era oriundo da indústria SOCOCOÒ Ltda, adquirido sete dias do início do período experimental. Foram avaliados os seguintes parâmetros: consumo e digestibilidade aparente da matéria seca (MS), proteína bruta (PB), da fibra em detergente neutro (FDN), fibra em detergente ácido (FDA), extrato etéreo (EE) e dos carboidratos não fibrosos (CNF). Os animais foram distribuídos em delineamento inteiramente ao acaso, com três tratamentos e oito repetições, e os dados gerados submetidos ao programa estatístico SASÒ pelo procedimento GLM, para análise de variância. Os Consumos de MS, PB, FDN e FDA, demonstraram redução linear com o aumento da inclusão de farelo de coco nas dietas. Sendo que os consumos de MS, PB e FDA, diferiram (P>0,05) nos níveis de inclusão; enquanto que o EE aumentou, não apresentando diferença nos níveis de 25% e 50% (P>0,05). Observou-se resposta linear decrescente para a digestibilidade aparente da MS, FDN e FDA de acordo com aumento dos níveis de farelo coco na dieta e resposta crescente para a digestibilidade do EE e PB, onde a maior digestibilidade ocorreu na dieta com níveis de inclusão de 50% e 25%, respectivamente. Entretanto, a digestibilidade de todos os parâmetros analisados não diferiram (P>0,05) quanto aos níveis de inclusão do farelo de coco no concentrado, concluindo-se que o farelo de coco não pode ser utilizado em níveis elevados na dieta de ovinos, pois pode comprometer o consumo e o desempenho dos animais.

  • KARYNNE DE NAZARE LINS DE BRITO
  • Avaliação das vias do metabolismo lipídico sobre os parâmetros qualitativos e quantitativos em oócitos bovinos maturados in vitro

  • Data: 18/03/2016
  • Mostrar Resumo
  • A importância da maturação oocitária sobre o desenvolvimento embrionário já se é bem estabelecido, porém sabe-se que o processo de cultivo in vitro provoca alterações celulares, o que leva a uma menor competência de oócitos que são maturados in vitro. Dentre essas alterações, pode-se citar reorganização inadequada das organelas durante a maturação, e disfunções metabólicas, como a super ou subexpressão de genes envolvidos na síntese de enzimas do metabolismo. Considerando-se isso, o objetivo do estudo foi avaliar como o ambiente ao qual o oócito é maturado, através da utilização de meios de maturação in vitro suplementados ou não com fatores de crescimento e antioxidantes, pode levar a alterações na maturação de oócitos bovinos. Assim, oócitos provenientes de abatedouro local foram submetidos a dois tipos de meio de maturação: 1) com suplementação com EGF, ITS e β- mercaptoetanol, 2) sem suplementação com essas moléculas. E foi avaliado a taxa de maturação nuclear, a quantidade de GL e a expressão dos genes FASN, FATP4, CD36 e CPT1A, todos envolvidos em diferentes vias do metabolismo lipídico. Observou-se então que a suplementação do meio não alterou a taxa de maturação nuclear (55,5 ± 7,7, e 65 ± 2,8, sem e com suplementação respectivamente. p=22). Assim como não houve diferença na quantidade de lipídios armazenados em oócitos imaturos (219,53 ± 1,31), e maturados com e sem suplementação (223,66 ± 1,92 e 220,16± 0,42, respectivamente). Contudo pode-se observar uma diferença na distribuição das GL entre os grupos, onde a maior diferença ocorre em oócitos maturados com suplementação. Não houve diferença significativa quanto a expressão do gene CD36 entre os grupos, contudo parece haver uma tendência (p=0,07) para uma maior concentração desse transcrito em oócitos imaturos. Conclui-se então que a suplementação não alterou de forma significativa o metabolismo nesses oócitos, contudo mais estudos precisam ser realizados para confirmar os dados aqui encontrados. 

  • MELINA GARCIA SARAIVA DE SOUSA
  • Infecção por Brucella abortus em búfalas (Bubalus bubalis

  • Data: 15/03/2016
  • Mostrar Resumo
  • O objetivo deste trabalho foi verificar a presen­ça de Brucella abortus e caracterizar as lesões causadas por esse agente nos anexos fetais, nos fetos e nos linfonodos de búfalas gestantes, sorologicamente positivas para brucelose. Para isso, foram utilizadas 20 búfa­las, em diferentes meses da gestação e ao parto, que foram submetidas ao abate sanitário. A idade fetal foi determinada através de exames ultrassono­gráficos associado à mensuração dos fetos durante a ne­cropsia. Todas as amostras foram coletadas em duplicata para análises de Reação em Cadeia de Polimerase em Tempo Real (qPCR) e histopatológica. As análises de qPCR revelaram a detecção de DNA de B. abortus a partir do segundo mês de gestação em líquido amniótico, líquido alantoide e em úte­ro e, a partir do quinto mês, na placenta, coração, baço, rim, pulmão, intestino, fígado e nos linfonodos dos fetos. Nos linfonodos das búfalas foi detectado a partir do quarto mês de gestação. Foi verificada a presença de DNA de B. abortus em todos os grupos de linfonodos avaliados, verificando-se em 10,52% nos linfonodos parotídeos, 5,26% nos linfonodos pré-escapulares, em 5,26% nos linfonodos mediastínicos, em 10,52% nos linfonodos pré-crurais e em 26,31% nos linfonodos mamários. Os achados macroscópicos foram placentite com exsudato de coloração acastanhada e odor fétido, com áreas de necrose e fibrina. Na histopatologia observou-se placentite caracterizada pela presença de necrose e denso infiltrado inflamatório por células polimorfonucleares, congestão, hemorragia e áreas com exsudação por fibrina, nos linfonodos linfadenite aguda crônica. Portanto, é possível detectar B. abortus desde o segundo até o último mês de prenhez em bubalinos, tanto nos líquidos fetais como nos tecidos e demonstra que a transmissão intrauterina é uma importante rota de infecção na cadeia epidemiológica da brucelose em bubalinos. Os linfonodos mais acomentidos foram os mamários, e a linfadenite regional demonstra a passagem das brucelas pelos linfonodos regionais nas áreas de infecção.

  • ALESSANDRA DOS SANTOS BELO REIS
  • Estudo da paratuberculose em búfalos (Bubalus bubalis) no estado do Maranhão

  • Data: 11/03/2016
  • Mostrar Resumo
  • Este trabalho teve como objetivo realizar um estudo da paratuberculose (PTB) em búfalos no estado do Maranhão. Para isso foi realizada a avaliação do uso da biópsia retal como diagnóstico ante mortem da PTB; dosagens dos teores de cobre, zinco e ferro, assim como, relatar a detecção de Mycobacterium avium subesp. paratuberculosis (Map) em útero e feto de búfalos com PTB. O estudo foi conduzido em duas propriedades no estado do Maranhão (São Mateus e São Luís). Foram realizadas biópsias retais de 140 búfalos e analisadas através da histopatologia, Ziehl-Neelsen (ZN) e PCR em tempo real (qPCR). Pela coloração de ZN, 4,3% (6/140) apresentaram bacilos álcool-ácido resistentes (BAAR) e na qPCR, 5,71% (7/140) tiveram amplificação do material genético. Onze búfalos foram eutanasiados e necropsiados, destes, quatro apresentaram lesões compatíveis com PTB na histopatologia e foram positivas no ZN e qPCR. Para a análise dos teores de microminerais foram utilizados 13 búfalos, foi realizada anteriormente biópsia retal. Sete animais foram positivos para PTB e os outros seis foram negativos. Foi realizada coleta de tecido hepático durante a necropsia. Na dosagem dos microminerais todos os animais com PTB apresentaram níveis abaixo dos valores de referência para Cu e Zn. Observou-se que a média dos teores de Cu dos búfalos com PTB foi 18,0ppm e de Zn 68,6ppm. Nos búfalos negativos, a média dos teores de Cu foi 113,7ppm e de Zn 110,0ppm. Os teores de Fe foram elevados (>670ppm) em todos os animais. Uma fêmea bubalina apresentava-se prenha e em estágio final da enfermidade, sendo submetida à eutanásia. Foram coletados fragmentos de diversos órgãos da fêmea e do feto. Para a detecção de Map foi realizado a extração de DNA dos tecidos coletados, seguida da aplicação da qPCR.  Dos tecidos coletados da fêmea bubalina detectou-se Map no útero, linfonodo mesentérico e intestino. Já no feto detectou-se a presença de Map apenas nos tecidos do sistema digestivo. A biópsia retal demonstrou ser promissora e pode ser empregada, juntamente com outras técnicas, para auxiliar no diagnóstico ante mortem em búfalos de rebanhos com suspeita de PTB. A paratuberculose pode induzir quadros de deficiência mineral ou agravar quadros de subdeficiência, com consequente piora do quadro clínico da doença nos animais. A presença de Map em búfalos ocorre em diferentes órgãos e tecidos, inclusive no sistema reprodutivo, e a transmissão intrauterina pode ser uma importante rota de infecção dentro da cadeia epidemiológica da PTB.

  • MARCO ANTONIO PAULA DE SOUSA
  • CRESCIMENTO RELATIVO DOS TECIDOS MUSCULAR, ADIPOSO E ÓSSEO NA CARCAÇA DE CORDEIROS CRUZA DORPER X SANTA INÊS E SANTA INÊS X SRD CONFINADOS PARA ABATE AOS 25, 28 OU 31 KG

  • Data: 01/03/2016
  • Mostrar Resumo
  • O trabalho teve como objetivo o estudo do crescimento relativo dos tecidos ósseo, muscular e adiposo, em relação à carcaça fria de cordeiros cruza dorper x santa inês e santa inês x srd, confinados para abate aos 25, 28 ou 31 kg. Foram utilizadas 72 carcaças de cordeiros, machos castrados, produtos do cruzamento (F1) das raças Dorper sobre Santa inês e Santa inês sobre SRD.  Dezoito cordeiros foram tomados ao acaso e abatidos (tempo zero de confinamentos) os remanescentes foram, então, alimentados ad libitum e aleatoriamente sorteados para serem abatidos aos 28; 56 e 84 dias de confinamento. Após abate e resfriamento da carcaça, foram separados os cortes comerciais pescoço, costela/fralda, costeleta, lombo, paleta e perna, os quais foram dissecados em músculo, osso e gordura. A soma de tecidos de cada corte equivaleu à composição tecidual da carcaça. O experimento foi instalado em esquema de parcela subsubdividida. O estudo do crescimento alométrico foi realizado utilizando-se a equação exponencial Y=aXb, transformada logaritmamente em regressão linear. A análise de variância dos dados referentes osso, músculo e gordura mostraram não existir interação entre grupamento genético, classes de peso medio inicial e tempo de permanência no confinamento.Os grupamentos genéticos determinaram diferença (P<0,05) quanto às proporções de osso e a relação M:O e M+G:O da carcaça. A classe de peso inicial influenciou a composição óssea (P<0,05). E tempos de permanência no confinamento influenciou (P<0,05), todas variaveis. Os cordeiros da classe de peso leve apresentaram crescimento precoce (b<1) do tecido ósseo e tardio do tecido adiposo para todos os grupamentos genéticos, exceto o tecido muscular que apresentou crescimento precoce (b<1) e tardio (b>1) para DSI e SISRD, respectivamente, em relação ao crescimento total da carcaça fria. O animais da classe intermediário apresentaram crescimento similar para os grupamentos, com crescimento isogônico (b=1) do tecido ósseo, precoce (b<1) do tecido muscular e tardio (b>1) do tecido adiposo. Na classe de peso pesado os houve crescimento precoce (b<1) e isogônico (b=1) do tecido ósseo para DSI e SISRD, respectivamente; e tardio (b>1) do tecido adiposo para todos os grupamentos e o tecido muscular apresentou crescimento tardio para DSI e precoce (b<1) para os SISRD. Com o incremento do peso de carcaça fria ocorre redução proporcional de osso e acréscimos proporcionais de músculo e gordura depositados na carcaça. O padrão de desenvolvimento observado infere que o abate de cordeiros DSI e SISRD, confinados com peso médio inicial de 25 ou 28 kg, contempla a melhor composição tecidual da carcaça quando realizado aos 31 kg.

  • JULIANE DA SILVA COSTA
  • CARACTERÍSTICAS E INDICES PRODUTIVOS DE MUÇUÃS (Kinosternon scorpioides) EM SISTEMA DE CATIVEIRO NA ILHA DE MARAJÓ, AMAZÔNIA, BRASIL



  • Data: 29/02/2016
  • Mostrar Resumo
  • Objetivou-se estudar o comportamento dos índices de características reprodutivas nas fases de acasalamento, postura e eclosão, em sistema de criação em cativeiro, visando nortear manejos adequados para a maior sustentabilidade da atividade. Foi conduzido um estudo no período de 2007 a 2015, em que foram analisados 84 eventos de acasalamento, 742 eventos de postura e 1.979 eventos de eclosão de animais em cativeiro, estes são pertencentes à Coleção Biológica de Muçuãs da Embrapa Amazônia Oriental - BAGAM, localizado no município de Salvaterra, ilha de Marajó-PA. Determinou-se: a estação reprodutiva (entre contínua e sazonal) e a distribuição dos acasalamentos em meses; a duração média do um evento de acasalamento em minutos; a relação macho:fêmea; a duração do período de desenvolvimento do ovo em dias; a estação de postura e a distribuição dos eventos em meses; a frequência de múltiplas posturas por estação reprodutiva; duração média do período de nidificação em minutos; a correlação entre tempo de nidificação e número de ovos; o número de ovos viáveis por período reprodutivo; a correlação entre número, peso, comprimento e largura dos ovos; a análise descritiva para as características biométricas e peso dos ovos; a duração média do período de incubação em dias; a estação de nascimentos; as análises descritivas de peso e medidas corporais para os filhotes e a correlação das variáveis. Os resultados demonstraram estação reprodutiva do tipo sazonal, concentrando os acasalamentos na época mais chuvosa do ano na região, em que a duração média de um evento de acasalamento foi de 00:23 + 00:28 minutos, com proporção macho:fêmea de 2,38 + 1,67. O período de desenvolvimento do ovo foi de 122,98 + 45,38 dias. A distribuição das posturas apresentou uma tendência de clímax entre o final de junho e o inicio de agosto. A duração média de um evento de nidificação foi de 02:57 + 01:19 minutos, de 7.885 no total de ovos postos, apenas 1.935 completaram seu desenvolvimento chegando a eclodir. Os resultados da correlação entre as características biométricas, peso e o número de ovos foram positivos, mas não significativos (P = <0,01). Obteve-se resultados biométricos do ovo de 34,5 mm de comprimento e 18 mm de largura, com peso médio de 7,90 g. A duração média do período de incubação, em dias, foi de 129,31 + 19,57. Os nascimentos se concentraram entre os meses de março a agosto. As correlações fenotípicas das características biométricas com o peso dos filhotes demonstraram que as correlações encontradas são positivas entre todas as variáveis. Portanto, as características reprodutivas estudadas permitem delinear um manejo reprodutivo visando a elaboração de um sistema produtivo de criação em cativeiro par a espécie.

  • JOELMA KYONE SILVA DE OLIVEIRA
  • Característica quantitativas e qualitativas do capim-Mombaça, submetido a doses crescentes de nitrogênio em clima tropical úmido – Classificação Af.

  • Data: 29/02/2016
  • Mostrar Resumo
  • Foi determinado o efeito da adubação nitrogenada (0, 10, 20, 30, 40 e 50 kg de N ha-1 aplicação-1), sendo cada aplicação realizada após cada corte, sobre a produção, composição química, características morfogênicas e estruturais do Panicum maximum cv. Mombaça avaliado em parcelas. O experimento foi delineado em blocos ao acaso e com uma repetição por bloco, sendo quatro blocos e seis tratamentos perfazendo um total de 24 parcelas. A adubação nitrogenada afetou linear e positivamente taxas de alongamento, aparecimento, número de folhas vivas por perfilhos e a produção de massa seca do capim-Mombaça. A qualidade da forrageira também foi afetada pelas doses de N, sendo os teores de PB influenciados positivamente e os valores de CT negativamente, consequentemente. O nitrogênio proporciona melhores resultados quantitativos e qualitativos para capim-Mombaça em regiões de clima tropical.

  • CÁSSIA MARIA PEDROSO DOS SANTOS
  • Relação entre a sorologia e a presença de cistos em tecidos de búfalos (Búbalos bubalis) infectados naturalmente com Toxoplasma gondii


  • Data: 29/02/2016
  • Mostrar Resumo
  • A Toxoplasmose é uma zoonose causada pelo protozoário apicomplexa Toxoplasma gondii, que tem como hospedeiro definitivo os felídeos que eliminam em suas fezes a forma infectante, os oocistos, transmitidos aos mamíferos e aves, principalmente, através da ingestão de alimentos e água contaminados. Devido o búfalo fazer parte da dieta alimentar paraense, são necessários mais estudos para investigar a infecção por T. gondii nesta espécie, uma vez que em seres humanos essa enfermidade pode ocasionar sérios danos à saúde. Com o objetivo de pesquisar a presença do protozoário T. gondii em amostras de sangue e cérebro de búfalos abatidos no município de Belém, através das técnicas de diagnóstico sorológica e molecular, foram coletadas 100 amostras de sangue e encéfalos de búfalos abatidos para consumo na cidade de Belém. Anticorpos IgG anti-T. gondii foram detectadas no soro usando a reação de imunofluorescência indireta (RIFI), onde 14% (14/100) dos búfalos foram soropositivos para T. gondii, com titulações de 64 e 256. A presença do gene B1 de T. gondii nas amostras de sangue e tecido cerebral, foi detectada por reação em cadeia da polimerase (Nested PCR) identificado a positividade em 3% (3/100) de sangue total e 1% (1/100) em tecido cerebral. As amostras positivas pela biologia molecular foram analisadas histologicamente em relação ao tecido cerebral, não havendo sido encontrado cistos ou lesões sugestivas da enfermidade. Este foi o primeiro trabalho a identificar mesmo que em baixas prevalência a presença do material genômico do T. gondii em amostras de búfalos abatidos na cidade de Belém, tornando ainda mais relevante a importância desses animais na cadeia epidemiológica da toxoplasmose como prováveis fontes de infecção principalmente para o ser humano.

  • SILVIA CRISTINA DA SILVA PEDROSO MAGALHÃES
  • Diagnóstico histopatológico e imunohistoquímico e determinação molecular do Mycobacterium bovis de lesões sugestivas de tuberculose em bubalinos abatidos para consumo no Estado do Amapá

  • Data: 26/02/2016
  • Mostrar Resumo
  • A tuberculose é uma enfermidade infecto-contagiosa de distribuição mundial, causada em bovinos e bubalinos, predominantemente pelo Mycobacterium bovis. A doença tem caráter crônico debilitante com impacto econômico na produção de carne e leite em diversas regiões do mundo e o agente infeccioso é uma importante zoonose. O presente trabalho se propõe a estudar por métodos diretos o M. bovis em lesões sugestivas de tuberculose em carcaças de bubalinos abatidos para consumo no Amapá, com tipificação molecular dos agentes isolados. A coleta das amostras de estudo foi realizada no período de setembro de 2014 a abril de 2015, onde se obteve 107 casos de lesões sugestivas de tuberculose. A seleção de amostras será feita segundo estritas recomendações específicas de cada tipo de diagnóstico, e encaminhadas para o processamento laboratorial. Para a análise histopatológica, fragmentos com cerca de 0,5 cm de espessura serão coletados e fixadas em formol tamponado a 10% e processadas através das técnicas habituais para inclusão em parafina, corado pela hematoxilina e eosina. Para a analise imunohistoquimica os cortes em lâminas positivadas (ImmunoSlide-EasyPath) foi utilizando o método anti-peroxidase peroxidase, onde as secções foram incubadas com um anti-soro policlonal de coelho contra o M. bovis (Dako B0124; 1/4000) na diluição de 1:100, incubadas pelo complexo streptavidina-biotina (LSAB) com o anticorpo secundário biotinilado universal e para a revelação das reações foi utilizado o cromógeno diaminobenzidina (DAB). Para a extração do DNA micobacteriano amostras foram maceradas e adicionada de 100 ml de tampão de homogeneização (tris-HCL 1M, pH 8,0; NaCl 1M; EDTA 0,5M, pH 8,0; sacarose), 100 ml de tampão de lise (tris-HCL 1M, pH 9,0; EDTA 10mM, pH 8,0; sucrose 20%, SDS 10%) e 5 ml de proteinase K (10 mg/ml). Esta mistura foi incubada a 56°C por 12 horas. À temperatura ambiente, foram adicionados 200ml de fenol-clorofórmio-álcool isoamil (25:24:1), depois homogeneizados por 10 minutos e centrifugados a 13.000 rpm por 10 minutos. A extração foi repetida com 200 ml de clorofórmio-álcool isoamil (24:1). O sobrenadante foi transferido para outro tubo e adicionou-se 30 ml de acetato de sódio (3M, pH 4,8) e 150 ml de isopropanol, para precipitação do DNA. O DNA foi, então, lavado com 500 ml de etanol a 70%, seco a 37°C e ressuspenso em tampão EDTA. Na identificação molecular de Mycobacterium bovis as reações de PCR para cada sequência alvo (RvD1-Rv2031C) foram realizadas para um volume de 20 ml contendo 1 mM a 2,5 mM de MgCl2,0,12 mM de cada desoxinucleotídeo, 10 pg de cada iniciador (JB21- TCG TCC GCT GAT GCA AGT GC, JB22- CGT CCG CTG ACC TCA AGA AG), glicerol 10%, tampão da Taq 1X, 0,5 U da enzima Taq DNA polimerase (Invitrogen) e20 a 100 ng do DNA alvo. (Rodrigues et al, 1995). Os produtos amplificados foram submetidos à eletroforese em gel de agarose 1%, corados com sybersafe (Invitrogen) e visualizados em transiluminador de luz ultravioleta.

  • GEISIELLY SOUSA ARAÚJO
  • Farelo de dendê (Elaeis guineensis) na alimentação de ovinos - degradabilidade in vitro, parâmetros ruminais e

    produção de gases 

  • Data: 25/02/2016
  • Mostrar Resumo
  • Os subprodutos da agroindústria do dendê possuem alta disponibilidade na Amazônia, e no decorrer dos anos, estudos mostram que podem ser alternativas viáveis para a suplementação alimentar de ruminantes, pois apresentam consideráveis teores de proteína e lipídeos, estes por auxiliarem na mitigação da produção de metano entérico, de interesse para a sustentabilidade dos sistemas de produção pecuária. Assim, o trabalho visa avaliar o uso do farelo de dendê na dieta de ovinos, em níveis crescentes de substituição, e seus efeitos na degradabilidade e parâmetros ruminais, além do potencial para mitigar gases de efeito estufa, como o metano.

  • JULIANA CRISTINA DE CASTRO BUDEL
  • Cinética de fermentação, produção de metano e parâmetros ruminais de ovinos alimentados com níveis de inclusão de torta de castanha-do-pará (Bertholletia excelsa Bonpl.)

  • Data: 25/02/2016
  • Mostrar Resumo
  • Objetivou-se avaliar a cinética de fermentação, produção de metano in vitro e parâmetros ruminais de ovinos alimentados com níveis de inclusão de torta de castanha-do-pará – TC (Bertholletia excelsa Bonpl.). A base da dieta foi composta por silagem de milho, acrescida de 0, 15, 30 e 45% de TC na matéria seca total, constituindo os tratamentos experimentais. Três experimentos ocorreram de maneira independente: digestibilidade e produção de gases no Laboratório de Nutrição Animal da Universidade Federal de Minas - UFMG, com delineamento em blocos casualizados (DBC), tendo como tratamentos seis níveis de inclusão do alimento (0, 15, 30 e 45, 60 e 100% de TC) e quatro blocos, com inóculos de vacas; produção de metano, no Centro de Energia Nuclear na Agricultura - CENA - USP, em blocos casualizados (DBC), tendo com tratamentos os seis níveis de inclusão e quatro blocos, com inóculos de ovinos, e parâmetros ruminais, na Unidade de Pesquisa Animal “Senador Álvaro Adolfo”, Embrapa Amazônia Oriental, PA, em delineamento inteiramente casualizado (DIC), com medida repetida no tempo, tendo como tratamentos os quatro níveis de inclusão e cinco repetições, em ensaio in vivo, utilizando-se ovinos. Neste último experimento, doze ovinos fistulados no rúmen, sem raça definida e peso médio de 35 kg, permaneceram em galpão fechado, contidos em gaiolas metabólicas individuais, para coleta do líquido ruminal, nos tempos zero, 2, 4, 6, 8 e 10h (pós-prandial), após 21 dias de adaptação. De posse das amostras, avaliou-se o pH, AGCC e N-NH3.

  • JOYCE CAROLINE DA SILVA TEIXEIRA
  • Estudo de uma alimentação artificial proteica para Melipona flavolineata
    (Hymenoptera: Apidae)

  • Data: 25/02/2016
  • Mostrar Resumo
  • A meliponicultura tem avançado consideravelmente nos últimos anos e,

    como
    consequência, aumentaram as demandas por colônias. Entretanto as

    técnicas de
    produção precisam ser aprimoradas para atingir a escala necessária. A

    alimentação das
    abelhas é uma das técnicas que precisam ser estudadas, pois existem

    longos períodos de
    escassez de florada, o que reduz a disponibilidade de alimento para as

    abelhas e limita a
    produção de colônias. O presente trabalho teve como objetivo estudar

    uma alimentação
    artificial proteica para Melipona jlavolineata. Foi investigado a

    composição nutricional
    do alimento natural (pólen estocado) e artificial (a base de extrato de

    soja), seus efeitos
    sobre a sobrevivência e tamanho dos imaturos e longevidade dos

    adultos. O alimento
    artificial apresentou composição nutricional diferente à composição

    nutricional do pólen
    (alimento natural). O alimento artificial é mais rico em carboidratos e

    lipídeos, porém
    mais pobre em proteinas. Contudo, a diferença não afetou a

    sobrevivência e tamanho
    dos indivíduos imaturos; foi afetada somente a longevidade dos

    indivíduos adultos. É
    recomendado que nas próximas fabricações, seja reduzida a

    quantidade de açúcar e
    adicionado ingredientes com teor de proteína mais elevado. A dieta a

    base de extrato de
    soja se mostrou um bom substituto para o pólen, mas não perfeito.

    Pequenos ajustes de
    ingredientes podem ser direcionados a partir dos resultados desse

    trabalho para se
    chegar a um alimento de melhor qualidade.

  • WLAISA VASCONCELOS SAMPAIO
  • Análise morfométrica dos espermatozoides de macaco de cheiro (Saimiri collinsi e Saimiri vanzolinii)

  • Data: 22/02/2016
  • Mostrar Resumo
  • A partir da morfometria espermática, é possível determinar espermatozoides viáveis e sugerir
    um índice global do grau de fertilidade in vivo e in vitro, com potencial para classificar
    amostras/doadores de acordo com a sua capacidade de fertilização. As recentes revisões da
    filogenia e sistemática que validaram a espécie Saimiri collinsi, e a vulnerabilidade à extinção
    do Saimiri vanzolinii, ascenderam ainda mais a necessidade de conhecer os aspectos
    reprodutivos desses primatas, afim de gerar informações a serem adotadas em programas de
    conservação in-situ e ex-situ. Com esta finalidade esse estudo objetivou (1) descrever a
    morfometria dos espermatozoides de S. collinsi e S. vanzolinii, (2) avaliar se os padrões
    morfométricos dos espermatozoides diferem entre as espécies, (3) avaliar se os padrões
    morfométricos dos espermatozoides têm relação com o percentual de patologias espermáticas
    da amostra/doador mesmo mensurando células morfologicamente normais (4) verificar as
    correlações dos parâmetros de avaliação seminal de rotina com a morfometria dos
    espermatozoides de amostras. Foram obtidas imagens de espermatozoides dos esfregaços de
    sêmen in natura, corados com eosina/nigrosina, coletados de 10 indivíduos de S. collinsi e dois
    de S. vanzolinii. Estas células foram mensuradas quanto aos parâmetros de cabeça (área [A],
    perímetro [P], comprimento [L], largura [W], elipticidade [EP] e alongamento [EL]) e
    comprimento da cauda [TL] e comprimento total do espermatozoide [TSL]. Foram encontrados
    os seguintes resultados: a) S. collinisi (grupo A) A= 20.98±0.10 μm 2 , P= 17.40±0.04 μm, L=
    6.24±0.01 μm, W= 4.27±0.01 μm, 1.46±0.005; 0.18±0.001; 70.49±0.19 μm; 76.70±0.19 μm;
    b) S. collinsi (grupo B) A= 20.28±0.11 μm 2 , P= 17.18±0.04 μm, L= 6.22±0.02 μm, W=
    4.14±0.01 μm, EP= 1.5±0.005 μm, EL= 0.20±0.001 μm, TL= 70.64±0.19 μm, TSL=
    76.86±0.19 μm; c) S. vanzolinii A= 25.36±0.09 μm 2 , P= 19.10±0.03 μm, L= 6.78±0.01 μm, W=
    4.75±0.01 μm, EP= 1.43±0.004, EL 0.17±0.001, TL= 69.27±0.09 μm, TSL 76.06±0.09 μm. Os
    tamanhos dos espermatozoides diferiram entre as espécies e a morfometria se alterou conforme
    a qualidade das amostras/animais. Em conclusão foi reportado pela primeira vez a morfometria
    dos espermatozoides de duas espécies de macaco de cheiro, de modo a fornecer uma base para
    avaliação do potencial de fertilidade em combinação com outros traços morfológicos e
    reprodutivos, e também foi sugerido que a morfometria espermática pode ser um critério
    taxonômico válido para o gênero.

  • ANTONIO MARCOS QUADROS CUNHA
  • Características morfogênicas, estruturais, acúmulo de forragem e composição química de capim-Massai, submetido à adubação nitrogenada

  • Data: 29/01/2016
  • Mostrar Resumo
  • Objetivou-se avaliar as características morfogênicas, estruturais e o acúmulo de biomassa do capim Panicum maximum cv. Massai submetidos ou não a diferentes doses de nitrogênio. Utilizou-se um delineamento em blocos casualizados com seis tratamentos (0; 100; 200; 300; 400 e 500 kg de N/ha/ano) e cinco repetições representadas por parcelas de 12 m². Foi utilizada a ureia como fonte de nitrogênio, cujas doses foram divididas em seis aplicações ao longo do período chuvoso, de acordo com os tratamentos. Foram avaliadas as seguintes características: taxa de alongamento de folhas, taxa de alongamento de hastes, taxa de aparecimento de folhas, filocrono, duração de vida da folha, taxa de senescência de folha, comprimento inicial de hastes, comprimento final de hastes, número de folhas vivas, número de folhas senescente, número de folhas mortas, composição morfológica, relação lâmina foliar:haste, altura, densidade populacional de perfilhos, acúmulo de forragem, número de dias de descanso, número de ciclos de corte e composição química. Houve aumento (p<0,05) na taxas de alongamento, aparecimento e senescência de folhas, bem como, no número de folhas vivas, número de folhas senescente e número de folhas mortas por perfilho a medida que aplicou-se o nitrogênio. Por outro lado, a adubação nitrogenada diminui (p<0,05%) o filocrono e a duração de vida das folhas no capim-Massai, o que indica efeito direto do nitrogênio no fluxo de tecidos. Observou-se efeito quadrático (p<0,05) na taxa de alongamento de hastes. Não foi observado efeito no comprimento inicial (p=0,67) e final de hastes (p=0,86). Não houve efeito nos percentuais de lâmina foliar (p=0,25) e material morto (p=0,20). Observou-se aumento (p<0,05) no percentual de hastes e redução (p<0,05) na relação lâmina foliar:haste. Não foi observado efeito na altura (p=0,58) e densidade populacional de perfilhos nos períodos chuvoso (p=0,39) e seco (p=0,35). No entanto foi observado diferença (p<0,05) na média da densidade populacional de perfilhos com maior número de perfilhos no período chuvoso comparado ao seco. Observou-se efeito quadrático (p<0,05) da adubação nitrogenada no acúmulo de forragem por ciclo, acúmulo de forragem diário, acúmulo de forragem total e acúmulo de lâmina foliar. Houve aumento (p<0,05) no acúmulo de hastes. Por outro lado não houve efeito (p=0,10) sobre o acúmulo de material morto. O número de dias de descanso diminuiu (p<0,05) se ajustando ao modelo linear, enquanto que no número de ciclos foi observado efeito quadrático (p<0,05). Houve redução (p<0,05) no percentual de matéria seca e teor de matéria mineral. Por outro lado, a adubação nitrogenada aumentou (p<0,05) os teores de matéria orgânica, proteína bruta e hemicelulose. Não foi observado efeito sobre os teores de fibra insolúvel em detergente neutro (p=0,54) e fibra insolúvel em detergente ácido (p=0,25). A adubação nitrogenada no capim-Massai atua no fluxo de tecidos aumentando a produção de forragem principalmente o componente folha. Aumenta também os teores de proteína. Fazendo com que essa prática seja uma alternativa visando melhorar o desempenho das atividades pecuárias do país o que favorece a utilização deste cultivar em sistemas intensivos de produção. 

2015
Descrição
  • MÁRIO ARTHUR DA COSTA LEAL
  • Determinação da ocorrência de anticorpos anti-leptospira em búfalos (Bubalus bubalis) criados no bioma amazônico paraense

  • Data: 04/12/2015
  • Mostrar Resumo
  • A criação de búfalos vem se destacando dentre as diferentes produções pecuárias por várias regiões do mundo, devido ao potencial produtivo da espécie, que resulta em produtos com características específicas, de boa qualidade e com alto valor agregado. A carne do búfalo com baixo teor de gordura, maior teor proteico, e seu leite com maior rentabilidade industrial, além do couro e o uso para o trabalho e tração, tem feito da bubalinocultura um segmento econômico alternativo importante e atrativo. No Brasil, os búfalos foram introduzidos no final do século XIX, originários da Ásia, Europa e Caribe. Atualmente são criados em franca expansão em diferentes regiões do país, por apresentar alta rusticidade e adaptabilidade a diferentes climas e relevos, características que favorecem sua produção, representando uma opção econômica tanto para pequenos produtores quanto para produções mais tecnificadas brasileiras.

    Segundo dados do Instituto Brasileiro de Geografia e Estatística (IBGE), o estado do Pará se destaca por possuir o maior quantitativo bubalino brasileiro com cerca de 508 mil cabeças que estão distribuídas no baixo, médio amazonas e, principalmente, na Ilha de Marajó onde se encontra a maior concentração, com 378 mil animais, sendo a bubalinocultura o principal setor econômico da Ilha. O bioma amazônico reúne características favoráveis para a criação de bubalinos, onde estes animais são produzidos predominantemente de forma ultra extensiva, caracterizado por um deficiente controle nutricional e sanitário, tornando-os favoráveis a instalação de doenças infecciosas e carênciais, sendo, por isso, importante o controle, a investigação e o monitoramento de doenças nestes animais para que não diminuam seu potencial produtivo e consequentemente o lucro do criador.

    A leptospirose, uma das principais doenças infecciosas que podem acometer os búfalos, pode afetar desde a fertilidade do rebanho por causar aborto, até a qualidade e quantidade da produção de leite em decorrência de quadros clínicos de mamite, tornando-a uma doença importante pelos possíveis impactos negativos na cadeia produtiva bubalina. Além do efeito direto sobre a pecuária, principalmente a paraense, a leptospirose, uma antropozoonose, em decorrência das características do estado do Pará, que está localizado no bioma amazônico, região tropical, onde o clima favorece o desenvolvimento desta doença, pode ser considerada também um problema de saúde pública, com a possível participação do búfalo como elo importante na manutenção do ciclo da leptospirose para o ser humano.

    Diante da importância da bubalinocultura como importante e emergente segmento pecuário no Brasil, em especial para estado do Pará, associado ao negligenciamento do controle, investigação e monitoramento das doenças infecciosas nestes animais, o presente estudo teve como objetivo determinar a ocorrência de anticorpos anti-leptospira em soros sanguíneos de búfalos criados no bioma amazônico paraense.

    A criação de búfalos vem se destacando dentre as diferentes produções pecuárias por várias regiões do mundo, devido ao potencial produtivo da espécie, que resulta em produtos com características específicas, de boa qualidade e com alto valor agregado. A carne do búfalo com baixo teor de gordura, maior teor proteico, e seu leite com maior rentabilidade industrial, além do couro e o uso para o trabalho e tração, tem feito da bubalinocultura um segmento econômico alternativo importante e atrativo. No Brasil, os búfalos foram introduzidos no final do século XIX, originários da Ásia, Europa e Caribe. Atualmente são criados em franca expansão em diferentes regiões do país, por apresentar alta rusticidade e adaptabilidade a diferentes climas e relevos, características que favorecem sua produção, representando uma opção econômica tanto para pequenos produtores quanto para produções mais tecnificadas brasileiras.

    Segundo dados do Instituto Brasileiro de Geografia e Estatística (IBGE), o estado do Pará se destaca por possuir o maior quantitativo bubalino brasileiro com cerca de 508 mil cabeças que estão distribuídas no baixo, médio amazonas e, principalmente, na Ilha de Marajó onde se encontra a maior concentração, com 378 mil animais, sendo a bubalinocultura o principal setor econômico da Ilha. O bioma amazônico reúne características favoráveis para a criação de bubalinos, onde estes animais são produzidos predominantemente de forma ultra extensiva, caracterizado por um deficiente controle nutricional e sanitário, tornando-os favoráveis a instalação de doenças infecciosas e carênciais, sendo, por isso, importante o controle, a investigação e o monitoramento de doenças nestes animais para que não diminuam seu potencial produtivo e consequentemente o lucro do criador.

    A leptospirose, uma das principais doenças infecciosas que podem acometer os búfalos, pode afetar desde a fertilidade do rebanho por causar aborto, até a qualidade e quantidade da produção de leite em decorrência de quadros clínicos de mamite, tornando-a uma doença importante pelos possíveis impactos negativos na cadeia produtiva bubalina. Além do efeito direto sobre a pecuária, principalmente a paraense, a leptospirose, uma antropozoonose, em decorrência das características do estado do Pará, que está localizado no bioma amazônico, região tropical, onde o clima favorece o desenvolvimento desta doença, pode ser considerada também um problema de saúde pública, com a possível participação do búfalo como elo importante na manutenção do ciclo da leptospirose para o ser humano.

    Diante da importância da bubalinocultura como importante e emergente segmento pecuário no Brasil, em especial para estado do Pará, associado ao negligenciamento do controle, investigação e monitoramento das doenças infecciosas nestes animais, o presente estudo teve como objetivo determinar a ocorrência de anticorpos anti-leptospira em soros sanguíneos de búfalos criados no bioma amazônico paraense.

  • ALYNE CRISTINA SODRÉ LIMA
  • Predição de características de carcaça de ovinos

  • Data: 23/11/2015
  • Mostrar Resumo
  • Objetivou-se com este estudo predizer características de composição tecidual de

    carcaças ovinas classificadas e tipificadas de acordo com o Sistema Europeu de

    Classificação de Carcaças. Foram avaliadas 72 carcaças de cordeiros machos,

    castrados, oriundas de um ensaio experimental realizado com os grupamentos

    genéticos Dorper e Santa Inês, e 3 classes de peso inicial (26, 28 e 32 kg), distribuídos

    em bloco inteiramente casualizado, considerando como bloco o efeito do tempo de

    confinamento (0, 28, 56 e 84 dias), arranjados em ensaio fatorial 2x3 (GG x CP).

    Primeiramente, as carcaças foram classificadas e tipificadas de acordo com o Sistema

    Europeu. A avaliação dos efeitos de GG, CP e TC sobre as características de carcaça

    (quantitativas, qualitativas e composição tecidual) foi realizada utilizando-se Análise

    de Variância para as variáveis contínuas,  e o teste de Scheirer-Ray-Hare para as

    categóricas, a  nível de 5% de significância. As variáveis de composição tecidual

    foram analisadas seguindo a Classificação de Esquema de Carcaça. As características

    qualitativas consideradas foram pH’s inicial e final, temperaturas inicial e final,

    textura, cocção, coloração (L, a, b) e perda de resfriamento. As quantitativa foram

    Conformação e Acabamento e, as de composição tecidual da carcaça foram totais dos

    tecidos e relação entre eles na carcaça e nos cortes. Para análise de associação entre

    características foram calculados os coeficientes de correlação de Pearson. Empregou-

    se Análises de Agrupamento empregando os algoritmos Ward e Fuzzy, com a

    finalidade de agregar os caracteres de composição tecidual. Para obtenção de

    equações de predição desses caracteres, aplicou-se a técnica de Regressão de

    Mínimos Quadrados Parciais (PLS). 20,83% (15) das carcaças avaliadas foram

    classificadas como Esquema de Carcaças Leve (ECL) e 77,17% (57) como Esquema

    de Carcaças Pesadas (ECP). Essa classificação foi influenciada pelo tempo de

    confinamento, GG e CP. O mesmo ocorreu para PCQ que é a variável determinante

    sobre essa classificação. Animais Dorper (16,97 kg) geraram carcaças mais pesadas

    que os Santa Inês (16,00 kg). As médias de TC e CP aumentaram gradativamente

    conforme o acréscimo dos níveis de cada efeito. Das 15 carcaças consideradas leves,

    5 (33,33%) foram Dorper. Nesse esquema de classificação, 20% (3) das carcaças

    foram categorizadas como B  e 80% (12) como C e, 60% (9) como qualidade 1 e 40%

    (6) como 2. Para as características qualitativas da carcaça, não houve efeito

    significativo de GG e CP. Já para ECP, houve efeito de TC, GG e GGxCP sobre os

    escores de conformação e acabamento. A CP apresentou influência significativa

    apenas sobre a conformação. Maiores CP’s geraram carcaças com escores de

    conformação mais elevados, bem como animais de grupamentos genéticos  Dorper

    obtiveram maiores frequências para escores de conformação e acabamento de carcaça

    melhores. No ECL, para acabamento, somente a GGxCP foi significativo. Para todas

    as variáveis de composição tecidual houve efeito significativo do TC e, de CP para Mt

    (músculo total da carcaça) e Ot (osso total da pacarcaça). Para ECL, foram obtidos 3

    Cluster’s, que demostraram ser correlacionados positivamente com a variável de

    gordura inguinal.  Para ECP, foram obtidos 4 Cluster’s para acabamento  e 5 Cluster’s

    para conformação, ambas correlacionados com as características de composição

    tecidual da carcaça. As equações de predição para caraterísticas teciduais a partir de

    conformação, acabamento e PCQ mostraram uma boa predição para o músculo e

    gordura total da carcaça, com R2=0,91 e R2=0,87, respectivamente, e ruim para

    quantidade de osso , R2 = 0,46 para ECP. Para o ECL a partir de acabamento e PCQ,

    as equações mostraram uma boa predição para o músculo total, R2=0,89, e ruins para

    as de mais variáveis. Os PCQ e conformação e acabamento são bons preditores de

    composição tecidual de carcaça de ovinos em ECP.

  • PRISCILA REIS KAHWAGE
  • Respostas termolíticas e qualidade seminal de ovinos naturalizados
    criados em ambiente tropical

  • Data: 30/10/2015
  • Mostrar Resumo
  • O estudo teve como objetivo de aprofundar o conhecimento sobre o conhecimento características anátomo-funcionais de adaptabilidade e qualidade seminal de machos ovinos selecionados em clima tropical. Foram utilizados 16 machos ovinos, sendo 09 da raça Santa inês e 07 da raça Morada Nova, os quais foram submetidos a dois experimentos. O primeiro ensaio visou o monitoramento das respostas termorreguladoras e da qualidade seminal dos animais durante o verão, outono, inverno e primavera, cuja caracterização climática foi feita pela variação dos elementos climáticos mensurados, quais sejam: temperatura do ar, umidade relativa do ar, radiação solar e precipitação pluviométrica. Ao longo do ano, foram avaliados os atributos de pelame e da glândula sudorípara, taxa de sudação, variáveis fisiológicas (frequência respiratória, frequência cardíaca, temperatura de superfície de pelame, temperatura da epiderme e temperaturas superficiais da bolsa escrotal), qualidade seminal (motilidade espermática, concentração espermática, integridade de membrana plasmática e defeitos maiores, menores e totais) e homogeneidade de parênquima testicular, por meio de ultrassonografia. O tratamento estatístico foi realizado com uso dos procedimentos GLM e LSMEANS do programa statistical analysis system, versão 9.1.3. Observou-se diferenças significativas entre verão e as estações mais amenas (outono e inverno). No verão, a pelagem se tornou menos densa, menos espessa, com fibras mais curtas e grossas, com aumento da taxa de sudação e elevação das temperaturas superficiais e da temperatura retal. Houve redução dos referidos parâmetros durante o outono. A qualidade seminal foi mantida ao longo do ano, havendo incremento dos defeitos maiores no outono e defeitos menores, no verão. A homogeneidade do parênquima testicular também reduziu no verão. A finalidade do experimento dois foi avaliara a capacidade de dissipação de calor dos animais, após exposição à intensa carga radiante. Durante cinco dias de verão, os animais foram submetidos ao desafio térmico que consiste na manutenção do animal à sombra, seguida de exposição ao sol e retorno à sombra, com permanência de 1 hora em cada ambiente. Foram aferidas frequência respiratória, frequência cardíaca, temperatura de superficiais de tronco, dorso e bolsa escrotal, por termografia infravermelha. A qualidade seminal e integridade de parênquima testicular foram avaliadas antes e após o desafio, para avaliar o efeito do estresse térmico nesses parâmetros. No período 2, os valores observados apontam condição de estresse severo. No período 3, os animais retomaram os parâmetros basais, demonstrando elevada capacidade de dissipação de calor. As variáveis seminais e ultrassonográfica não sofreram ação do desafio. Assim, conclui-se que animais Morada Nova e Santa inês apresentam dinamismo morfofuncional eficiente que os favorece à adaptabilidade ao clima quente, de modo a conservar as características seminais mesmo em condições desafiadoras.

  • CAROLINA CARVALHO BRCKO
  • Respostas termorregulatórias e comportamentais de fêmeas bubalinas criadas a pasto, em condições de ambiente do Trópico Úmido

  • Data: 11/09/2015
  • Mostrar Resumo
  • Essa tese foi dividida em quatro experimentos e teve como objetivo geral avaliar a influência do clima sobre os mecanismos adaptativos de búfalas, bem como, verificar se a suplementação energética com torta de palmiste (Elaeis guineensis) é capaz de causar alterações fisiológicas e comportamentais em animais criados a pasto, sem acesso a sombra. Os experimentos foram realizados na Embrapa Amazônia Oriental (01°.26’.03” S e 48°.26’.03” W), no período de julho de 2013 a junho de 2014, com 24 búfalas mestiças de Murrah e Mediterrâneo. Os animais ficaram em piquete com capim Brachiaria brizantha (CV. Marandu) em sistema rotacionado, sem acesso a sombra, com acesso à água e sal mineral à vontade. O 1° experimento objetivou determinar os índices de conforto térmico mais adequados para búfalos criados nos trópicos.  Foram registrados dados de temperatura do ar (TA), umidade relativa do ar (UR), temperatura de ponto de orvalho, temperatura do bulbo úmido, temperatura de globo negro (TG), temperatura retal (TR), temperatura da superfície corporal (TSC), frequência respiratória (FR) e calculados os índices: Índice de Temperatura e Umidade (ITU), Índice de Temperatura de Globo e Umidade (ITGU), Índices de Condições Climáticas de Conforto de Búfalas geral, efetivo e prático (ICCCBg, ICCCBe e ICCCBp), Índice de Tolerância ao Calor de Ibéria (ITC Ibéria), Índice de Conforto Térmico de Benezra (ICB) e Índices de Conforto Ambiental para Búfalas geral, efetivo e prático  (ICABg, ICABe e ICABp), aferidos a cada 14 dias, no período da manhã (entre 6h00 e 7h00) e à tarde (entre 12h00 e 13h00). Conclui-se que todos os índices testados foram correlacionados às variáveis fisiológicas, sendo que os índices ITU, ITGU, ICCCBg, ICCCBe, ICCCBp, ICABg, ICABe e ICABp são mais eficientes para avaliar o conforto térmico de búfalas, nas condições climáticas da Amazônia Oriental. O 2° experimento teve como objetivo estudar a capacidade de troca e conservação de calor diária de búfalas. O experimento teve duração de 6 dias. Foram realizadas 6 coletas por dia, iniciando as 6h e finalizando as 21h, com intervalo de 3 horas entre elas. Os animais foram conduzidos ao centro de manejo 30 minutos antes de cada coleta. As variáveis ambientais estudadas foram as mesmas do experimento anterior. As variáveis fisiológicas coletadas foram TR e FR. Para registro da TSC foi utilizada uma câmera termográfica modelo FLIR E30. Conclui-se que apesar de expostos a condições climáticas adversas, os búfalos são capazes de retornar a sua homeostase ao final do dia, indicando que a espécie possui grande capacidade adaptativa. O 3º experimento teve como objetivo avaliar os efeitos do clima e da inclusão de quatro níveis (0; 0,25; 0,5 e 1% do PV) de torta de palmiste na termorregulação de búfalas Murrah-mediterrâneo. As variáveis ambientais e fisiológicas foram as mesmas citadas no primeiro experimento. Os animais receberam alimentação diária, em cochos individuais e a dieta foi ajustada, mediante nova pesagem dos animais, a cada 28 dias. Concluiu-se que os tratamentos não foram significativos, indicando que nas condições estudadas, a torta de palmiste não foi capaz de amenizar o efeito do ambiente sobre os animais. O 4° experimento teve como objetivo verificar se a inclusão da torta de palmiste, em diferentes níveis (0; 0,25; 0,5; 1% do PV) é capaz de alterar o comportamento de pastejo de búfalas criadas a pasto. O experimento foi realizado em dois períodos distintos do ano (mais chuvoso e menos chuvoso). As variáveis climáticas analisadas são as descritas no experimento 1. A análise comportamental teve duração de 3 dias consecutivos e foi realizada no período das 6 as 18h. Os animais foram numerados com tinta branca de 1 a 24, de forma a facilitar a visualização, sendo 6 animais para cada tratamento. A cada 5 minutos foi registrada, em planilha, a atividade feita por cada animal (pastejando, ruminando, ócio). Conclui-se que a dieta não influenciou no comportamento. O comportamento foi influenciado pela turno do dia, sendo que os animais permaneceram mais tempo em ócio no período com temperaturas mais elevadas. 

     

  • ALUIZIO OTAVIO ALMEIDA DA SILVA
  • Estudo ultrassonografico da dinamica folicular, atividade ovariana e involução uterina no pós-parto de bufalas (bubalus bubalis) criadas na região amazonica.

  • Data: 11/08/2015
  • Mostrar Resumo
  • Serão utilizadas dez bufalas da Embrapa, da raça Murrah e Mediterranea, suadaveis, uma semana após o parto com idade entre quatro a oito anos e eCC variando de 2,5 a 3,5. As bufalas serão divididas em dois grupos, o grupo Murrah e grupo Mediterranea. Serão submetidas a exames ultrassonograficas após o parto, em dias alternados até as femeas apresentarem um segundo corpo luteo, caracterizando um ciclo estral completo, associado a este exame será realizada o acompanhamento da involução uterina, mensurando a diminiuição da parede dos cornos uterino gestante e não gestante.

  • ADRIANA NOVAES DOS REIS
  • AVALIAÇÃO DA QUALIDADE DO SÊMEN BUBALINO CRIOPRESERVADO EM
    MEIO ACP-112®, E EM MEIO TES ACRESCIDO DE ÓLEO ESSENCIAL
    EXTRAÍDO DA SÁLVA DO MARAJÓ (Lippia origanoides)

  • Data: 11/08/2015
  • Mostrar Resumo
  • A inseminação artificial (IA) tem servido como instrumento de ampla difusão do potencial genético de animais de alta produção, através da criopreservação do sêmen, que tem como funções principais, a suspensão do metabolismo dos espermatozóides e a manutenção das características espermáticas por um período prolongado de tempo .A adição de óleo essencial extraído da Salva-do-Marajó, em diferentes concentrações, durante o processo de criopreservação, seria capaz de elevar os parâmetros de motilidade seminal, reduzir os níveis de danos estruturais e melhorar a qualidade do sêmen pós-descongelação. Avaliar os efeitos da adição do óleo essencial obtido através do extrato da Salva do Marajó sobre a integridade dos espermatozóides bubalinos criopreservados no diluente TES. Avaliar a congelabilidade do sêmen bubalino diluído e criopreservado em TES, associado ao óleo essencial da Salva do Marajó, Avaliar o efeito de três diferentes concentrações do óleo essencial da Salva do Marajó associado ao diluente TES, sobre a motilidade, o vigor, e a percentagem de vivos e mortos após o processo de criopreservação;   Determinar a concentração ideal do óleo essencial da Salva do Marajó associado ao diluente TES para a congelação do sêmen bubalino;Avaliar a resistência de espermatozóides bubalinos criopreservados em TES e três concentrações de óleo essencial através do teste de termo resistência rápido; Avaliar a integridade e a funcionalidade da membrana plasmática dos espermatozóides criopreservados em TES e três concentrações de óleo essencial, através de um teste hiposmótico e da coloração com a Eosina;Avaliar a integridade da membrana plasmática e da membrana acrossomal dos espermatozóides de bubalinos criopreservados em TES e na presença do óleo essencial, através citometria de fluxo utilizando as sondas Iodeto de Propídio e FITC-PSA;Avaliar a atividade mitocondrial dos espermatozóides bubalinos criopreservados em TES e óleo essencial, através citometria de fluxo, utilizando a sonda JC-1;

     

  • ADRIANA NOVAES DOS REIS
  • AVALIAÇÃO DA QUALIDADE DO SÊMEN BUBALINO CRIOPRESERVADO EM MEIO ACP-112®, E EM MEIO TES ACRESCIDO DE ÓLEO ESSENCIAL EXTRAÍDO DA SÁLVA DO MARAJÓ (Lippia origanoides)

  • Data: 11/08/2015
  • Mostrar Resumo
  • A inseminação artificial tem servido como instrumento de ampla difusão do potencial
    genético de animais de alta produção, através da criopreservação do sêmen. Entretanto este
    processo produz danos às membranas e às estruturas dos espermatozóides, causados pelo
    estresse oxidativo induzido pela geração de espécies reativas de oxigênio. Para diminuir estes
    prejuízos foi avaliado o efeito da suplementação do meio diluidor com diferentes
    concentrações de óleo extraído da Lippia origanoides, planta característica da região
    Amazônica, como um antioxidante natural para auxiliar na proteção dos espermatozóides
    bubalinos pós-criopreservação. Foram utilizados 5 touros bubalinos para as colheitas de
    sêmen, sendo os ejaculados diluídos em meio TES acrescido de 10 g/mL, 5 g/mL e 2,5
    g/mL da planta e um grupo controle, constituído somente do meio diluidor. O sêmen fresco
    foi analisado quanto a características macro e microscópicas convencionais de rotina, tais
    como, motilidade, vigor, concentração, morfologia e coloração com Eosina-Citrato. Após a
    descongelação das amostras foram avaliadas novamente, motilidade, vigor e coloração supravital,
    e posteriormente os testes de termo-resistência, teste hiposmótico e de avaliação da
    integridade das membranas dos espermatozóides através das sondas fluorescentes PI, FITCPSA
    e JC-1, utilizando a citometria de fluxo. Os dados obtidos foram submetidos à ANOVA
    e Teste de Tukey a 5%. Os resultados obtidos após as análises, não mostraram nenhuma
    diferença entre os grupos testados (p>0,05), com relação a motilidade para as concentrações
    de 10 g/mL (37,50%), 5 g/mL (37,81%), 2,5 g/mL (35,00%), e grupo controle (37,81%);
    assim como, para a viabilidade dos espermatozóides pós-descongelação, visto que foram
    encontrados valores de 47,97% (10 g/mL), 49,19% (5 g/mL), 43,81% (2,5 g/mL), e
    45,28% (controle). As percentagens de HOST positivo, de integridade da membrana
    plasmática e acrossomal e do potencial mitocondrial para as mesmas diluições de 10 g/mL
    (38,69%; 55,97%; 30,89%), 5 g/mL (42,09%; 54,29%; 31,47%), 2,5 g/mL (42,78%;
    53,49%; 32,17%) e controle (42,88%; 54,09%; 31,87%), também não apresentaram
    diferenças (p>0,05) entre os grupos analisados. Estes dados demonstram que nas
    concentrações utilizadas, o óleo essencial da Lippia origanoides não causou nenhum efeito,
    seja positivo ou negativo, nos espermatozóides bubalinos criopreservados, sendo necessárias
    mais pesquisas voltadas para a avaliação do efeito da Lippia sobre a criopreservação do
    sêmen em bubalinos.

  • LARISSA COELHO MARQUES
  • CARACTERÍSTICAS FENOTÍPICAS E MANEJO GENÉTICO DE BÚFALOS (Bubalus bubalis) LEITEIROS NA AMAZÔNIA: RANKING DE REPRODUTORES

  • Data: 10/07/2015
  • Mostrar Resumo
  • O búfalo é um animal que pode competir com produtos diferenciados nos mercados interno e mundial, que apresenta características próprias e grande rendimento quando da transformação em subprodutos e derivados. Não obstante a isso, o agronegócio do búfalo se ressente de animais melhoradores provados e/ou testados para atender uma demanda que é vital por melhor padrão genético. O presente estudo teve objetivo de avaliar características fenotípicas da produção de leite e da eficiência reprodutiva de búfalos e efetuar análises genéticas, determinando parâmetros e índices genéticos, visando a seleção de búfalos, para a elaboração de um ranking de reprodutores geneticamente superiores, incrementando a cadeia produtiva dos búfalos na Região Amazônica. Foram utilizados 2.322 registros fenotípicos de búfalos das raças Murrah, Mediterrâneo e meio-sangue, do rebanho da EMBRAPA – CPATU, do período de 1953 a 2013. As características avaliadas foram: produção total de leite (PTL), percentual de gordura (G), idade ao primeiro parto (IPP), intervalo de partos (IDP) e período de serviço (PS). A análise descritiva se iniciou com a editoração dos dados trabalhados nos ambientes da planilha Microsoft Excel e no pacote SAS. Os resultados gerais foram: PTL = 1741,00 ± 496,48 kg, G = 7,07 ± 0,86 %, IPP = 49,39 ± 7,37 meses, IDP = 13,16 ± 0,79 meses e PS = 91,52 ± 24,22 dias. Na análise de variância para PTL os efeitos de variância mais significativos foram a ordem de parto e o grau de sangue da fêmea, para G foi grau de sangue da fêmea, para IPP foi estação de parto e ordem de parto e para IDP e PS foram estação de parto e o sexo do bezerro. As correlações fenotípicas entre PTL e G foi 0,034, entre PTL e IPP 0,118, entre PTL e IDP 0,070, entre PTL e PS 0,070, entre G e IPP -0,113, entre G e IDP -0,025, entre G e PS -0,025, entre IPP e IDP 0,445, entre IPP e PS 0,445 e entre IDP e PS 1,00. As análises genéticas se iniciaram com a editoração dos dados trabalhados nos ambientes da planilha Excel e do pacote SAS e as análises genéticas foram efetuadas pelo software WOMBAT. Na estimação de parâmetros genéticos foi utilizado o modelo animal com análise de bicaracterísticas. A PTL foi regredida em função da duração de lactação e o coeficiente de regressão foi utilizado para correção das lactações em 305 dias (PL305). Os efeitos fixos foram grupo de contemporâneos e efeito linear e quadrático da idade da fêmea ao parto, como (co)variável. Para IPP e PS o modelo foi igual ao anteriormente descrito com a exclusão do termo do efeito de ambiente permanente materno. As estimativas de herdabilidade para a raça Murrah foram: 0,49; 0,59, 0,75, 0,006 e 0,06; para a raça Mediterrâneo foram: 0,31; 0,08, 0,78, 0,90 e 0,90 para PTL, G, IPP, IDP e PS, respectivamente. As correlações genéticas de PTL e G, PTL e IPP, PTL e IDP e PTL e PS para Murrah, foram 0,065, 0,097, -0,450 e 0,079, respectivamente, para Mediterrâneo foram: -0,267, 0,629, 0,559 e 0,624. O ranking de touros/reprodutores foi elaborado com base nas predições da Provável Habilidade de Transmissão (PTA’s), utilizando-se o pacote SAS, o que permite a edição de um catálogo de touros da espécie bubalina da Embrapa Amazônia Oriental, no referido período. Com base nos resultados a variabilidade do rebanho estudado é passível de ser trabalhado com o manejo genético tanto para as características produtivas quanto para as de eficiência reprodutiva.

  • THIAGO VELASCO GUIMARAES SILVA
  • ESTUDO DA INTEGRIDADE DA PROTAMINA E DA REMODELAÇÃO DA CROMATINA ESPERMÁTICA UTILIZANDO SÊMEN SEXADO EM BOVINOS

  • Data: 03/07/2015
  • Mostrar Resumo
  • Na produção in vitro de embriões observa-se a necessidade de mais pesquisas voltadas para o espermatozóide, visto que a boa qualidade e a integridade do mesmo, principalmente a nível molecular, são fundamentais para a formação de um novo indivíduo. Durante o processo de fecundação a substituição das protaminas por histonas é importante. Entretanto, não há estudos que descrevam tal remodelação nuclear na espécie bovina e sua influência no desenvolvimento embrionário. Sendo assim, o objetivo desta revisão é descrever este remodelamento cromatínico e verificar se falhas no mesmo estão associadas ao bloqueio do desenvolvimento embrionário, utilizando-se sêmen convencional e sêmen sexado.

  • JEFFERSON PINTO DE OLIVEIRA
  • Distribuição espacial de anticorpos IgG para Toxoplasma gondii em um estudo soroepidemiológico realizado em bovídeos no Estado do Pará

  • Data: 30/06/2015
  • Mostrar Resumo
  • O Toxoplasma gondii é um protozoário coccídeo cosmopolita, que tem nos animais domésticos e silvestres seus hospedeiros intermediários, e o homem como hospedeiro acidental, e que neste determina uma grave doença zoonótica, em que uma das mais importantes vias de infecção é a ingestão de cistos viáveis, presentes em carnes de animais infectados.  O Estado do Pará possui o quinto o maior rebanho do país e o primeiro em quantidades de bubalinos, além de ser o maior exportador de bovino em pé, e a quantidade de abate não oficial, ou seja, sem serviço de inspeção oficial está em torno de 30% dos animais consumidos pela população paraense. Portanto, a determinação da soroprevalência de anticorpos imunoglobulina da Classe G (IgG) específicos desta parasitose em bovídeos criados, contribui para o conhecimento da epidemiologia desta zoonose no Estado do Pará. O estudo foi realizado em todas as mesorregiões paraenses, em que foram colhidas amostras de sangue de 2.070 animais, sendo 1.750 da espécie bovina e 320 bubalina, em 51 municípios e 100 propriedades, com levantamento dos seus aspectos epidemiológicos que influenciam o aparecimento do agente infeccioso. Os soros dos animais foram submetidos ao teste do Kit de ELISA – Ensaio Imunoenzimático e de Reação de Imunofluorescência Indireta – RIFI segundo Camargo (1964) para a detecção de anticorpos IgG específicos para T. gondii bovino e bubalino da empresa Imunodot®. Os animais foram considerados positivos no teste de RIFI a partir da diluição de 1:64. Considerou-se diferença estatística p ≤ 0,005. Os bubalinos apresentaram maior soropositividade que os bovídeos, assim como o teste de RIFI foi superior ao teste de ELISA, e a Mesoregião que apresentou maior sororeagentes foi o Baixo Amazonas e as propriedades que apresentaram maior quantidade de felídeos é a que tinha a maior presença de anticorpos do agente nos animais analisados.

  • ELIZABETH MACHADO BARBOSA
  • Caracterização Molecular da Região Promotora do Gene do Receptor da Melatonina e Associações de Polimorfismos com Características de Fertilidade em Búfalas na Amazônia

  • Data: 18/06/2015
  • Mostrar Resumo
  • A produção de búfalos no Brasil tem crescido ao longo dos anos e paralelo, os desafios de associar os marcadores moleculares em búfalas para melhorar os índices produtivos e reprodutivos. Sendo assim, o objetivo deste estudo é Caracterizar a região Promotora do Gene Receptor da Melatonina 1A e associar os polimorfismos detectados com as concentrações de parto, intervalo entre partos e eficiência reprodutiva de búfalas criadas em sistemas intensivos e extensivos nos estados do Amapá e Pará. Será realizado o método do PCR e posterior sequenciamento desses produtos de PCR. As sequências serão editadas utilizando o programa computacional Finch TV Versão 1.4.0 (Geospiza Research Team, USA), sendo sempre comparadas com as sequências contidas no Genebank através do sistema BLAST e em seguida serão alinhadas para comparação das mesmas entre os animais para detectar os possíveis polimorfismos. Os domínios de ligação dos fatores de transcrição na região promotora serão identificados por comparação com diferentes espécies com auxílio do programa TRANSFAC 4.0 (WINGENDER et al., 2001) e caracterizar os possíveis domínios de ligação dos fatores de transcrição quanto aos possíveis polimorfismos detectados. As frequências alélicas e genotípicas serão estimadas utilizando o método de contagem direta. As proporções de possíveis desvios do equilíbrio de Hardy-Weinberg serão testadas por comparações das frequências genotípicas e será avaliado o desequilíbrio de ligação entre os pontos polimórficos. Todas essas análises serão realizadas com auxílio do programa computacional GENEPOP (RAYMOND; ROUSSET, 1995). Para as características de intervalo de parto, período de serviço e concentração de parto/mês, as análises serão realizadas utilizando modelos lineares através do aplicativo PROC MIXED do pacote estatístico do SAS 8.0 (SAS Institute, Inc. 2000), assumindo distribuição normal dos dados.

  • STEFANIA ARAUJO MIRANDA
  • Reprodução do Guará (Eudocimus ruber) no Parque Mangal das Garças: uma ferramenta para a conservação da espécie.

  • Data: 12/06/2015
  • Mostrar Resumo
  • A população de Guará é decrescente e essa ave é considerada extinta em diversas regiões onde antes era avistada. A reprodução ex situ pode ser uma ferramenta para a conservação in situ dessa espécie. No entanto, o guará ainda não apresenta um manejo reprodutivo eficiente em cativeiro. Nesse sentido, o objetivo do trabalho foi desenvolver, em condições artificiais, ambientação e alimentação adequadas para a criação de filhotes de guará, a fim de intensificar a reprodução e aumentar o número de indivíduos no Parque Mangal das Garças, bem como descrever o período reprodutivo, a incubação dos ovos, o desenvolvimento do filhote e estabelecer parâmetros para determinar a idade. O período de postura de ovos ocorreu em junho de 2012 a maio de 2013, agosto de 2013 a janeiro de 2014 e setembro a dezembro de 2014. Os ovos foram incubados com temperatura e umidade de 37,4ºC e 60%, respectivamente. A média do período de incubação foi de 22,95 ± 0,14 dias. No ano em que todos os filhotes foram criados artificialmente, o número de nascimentos e de indivíduos que alcançaram a vida adulta foram maiores. A ambientação e o protocolo alimentar desenvolvidos foram avaliados por meio de pesagens dos filhotes, a cada cinco dias. Os filhotes nasceram com 29,5±0,83g e as médias foram crescentes do 6º ao 36º dia de vida, confirmando o ganho de peso, pois com 36 dias, os filhotes pesavam 303±10g. Cinco filhotes foram alimentados com papa contendo somente ração (PR), 10 alimentados com papa contendo peixe (PP) e 10 com papa contendo camarão (PC). Os cinco filhotes alimentados com PR vieram a óbito na primeira semana de vida, não sendo avaliado o desempenho desses filhotes. O desempenho dos filhotes foi mensurado por meio de pesagens diárias e biometrias semanais do rádio, da tíbia, do tarso e da porção despigmentada do bico, do 1º ao 35º dia de vida. A partir do 14º dia de vida, as médias do peso, do rádio, da tíbia e do tarso foram maiores nos filhotes alimentados com a PP (P<0,05). As médias da porção despigmentada do bico não apresentaram diferenças significativas, provavelmente por ser uma característica do filhote que não tem relação com a alimentação e desempenho do animal. As PR, a PP e a PC apresentaram 33,45%, 44,33% e 42,38% de proteína bruta, respectivamente. A quantidade de proteína na PR foi considerada inadequada para os filhotes. As porcentagens de proteína na PP e PC foram similares. No entanto, a porcentagem de FDN e FDA foram maiores na PC do que na PP. Portanto, o maior desempenho dos filhotes alimentados com a PP pode estar relacionado com a digestibilidade, que na PP foi melhor. O bico do guará, no 7º dia de vida, começou a pigmentar na porção proximal até ficar completamente pigmentado a partir do dia 35. No dia 4,73 ± 0,12, os filhotes abriram os olhos, com 6,31 ± 0,18 dias se movimentavam dentro do ninho e no dia 15,3 ± 0,68 saíram do ninho. Esses parâmetros possibilitam estimar a idade do filhote do guará ex situ e in situ, sem a necessidade manipular o filhote. As médias dos pesos e das biometrias do tarso, da tíbia e do tarso foram crescentes do 1º ao 42º dia de vida, apresentando diferenças significativas entre os dias. Já as médias da porção despigmentada do bico diminuíram significativamente. Os coeficientes de determinação mostraram que existe alta relação do peso e das biometrias com idade, podendo ser utilizados para determinar a idade do filhote de guará.

  • JULIANNE SILVA DE LIMA
  •  Influência do contexto social na coagulação seminal, liquefação do coágulo, qualidade espermática e resfriamento do sêmen de macacos-prego (Sapajus apella).

  • Data: 08/06/2015
  • Mostrar Resumo
  • O objetivo deste estudo foi amprimorar o desenvolvimento de técnicas do sêmen em macacos-prego (Sapajus apella), verificando a influência do contexto social sobre a consistência do sêmen, o tempo de liquefação do coágulo, e a qualidade espermática; e analisar o efeito da adição de diferentes concentrações do antioxidante Trolox (0, 100 e 150 μM) na manutenção da qualidade espermática durante a liquefação e após o resfriamento do sêmen. Foram utilizados os dados de 5 anos de coletas seminais em 41 machos adultos mantidos em cativeiro, alojados em recintos individuais e em gaiolas de convívio agrupado. Imediatamente após a ejaculação o volume e a viscosidade seminal foram avaliados. O sêmen obtido foi classificado de acordo com uma escala subjetiva de consistência. Para a liquefação do coágulo seminal, foi utilizado o diluidor à base de água de coco em pó (ACP®118). A avaliação da qualidade espermática foi realizada pela análise dos parâmetros (concentração, pH, motilidade, vigor, integridade de membrana plasmática e morfologia dos espermatozoides) após a liquefação parcial do coágulo seminal. Para o resfriamento do sêmen, as amostras foram arrefecidas de 36 ºC para 4 ºC, em 90 minutos (- 0,4 ºC/min) e os parâmetros espermáticos foram avaliados logo após o término do resfriamento. Para a avaliar o efeito do antioxidante, o sêmen foi destinado em 3 tratamentos: Grupo controle - diluidor ACP®118 sem adição de antioxidantes; Grupo T100 - ACP®118 acrescido do antioxidante Trolox a 100 μM; e Grupo T150 - ACP®118 acrescido de Trolox a 150 μM. Os animais mantidos em grupos apresentaram os graus mais consistentes de coagulação seminal, associados com piores resultados de motilidade e integridade da membrana plasmática dos espermatozoides, enquanto que aqueles mantidos individualmente, apresentaram coágulos menos consistentes e melhor qualidade espermática. O tempo de liquefação do semen não foi influenciado pelo contexto social, mas nos animais mantidos em grupo, o grau IV possuiu maior tempo para se liquefazer em comparação aos outros graus analisados. O tratamento com antioxidante T150 melhorou significativamente a motilidade espermática durante a liquefação parcial do coágulo. Após o resfriamento seminal, não houve diferença significativa entre o grupo controle e os tratamentos T100 e T150. Conclui-se que o contexto social influencia na coagulação seminal e na qualidade dos espermatozoides de S. apella e que o protocolo adicionando trolox a 150 μM no diluidor seminal permite a manutenção da qualidade espermática durante a liquefação parcial do sêmen.

  • ANNA PATRYCIA MARTINS DE OLIVEIRA
  • Estudo morfofisiológico do epidídimo de caititus (Pecari tajacu) adultos.

  • Data: 29/05/2015
  • Mostrar Resumo
  •  O presente trabalho visou estudar os aspectos morfofisiológicos das diferentes partes de epidídimos de caititus (Pecari tajacu), bem como as patologias encontradas nos espermatozóides existentes no órgão. Foram utilizados oito animais adultos, na faixa etária de dois a quatro anos, procedentes do criatório de pesquisas científicas da EMBRAPA-Amazônia Oriental, localizado em Belém, Pará, Brasil. Os epidídimos foram separados dos testículos. Cada uma das quatro partes do epidídimo (cabeça proximal, cabeça distal, corpo e cauda) foi dividida em duas porções, sendo que uma das porções foi macerada, enquanto a outra permaneceu intacta. A cauda do epidídimo não sofreu maceração, devido ao fato da mesma ter sido submetida à técnica de fluxo retrógado. As porções maceradas e a cauda foram armazenadas a uma temperatura de 5ºC sendo utilizadas, posteriormente, para visualização de patologias de cabeça, corpo e cauda dos espermatozóides. As porções intactas foram embaladas em gaze, identificadas e colocadas em  solução ALFAC. Posteriormente foram submetidas à aplicação de técnicas de processamento histológico.

  • JOSE ALCIDES SARMENTO DA SILVEIRA
  • ENFERMIDADES PODAIS EM BOVINOS DE CORTE CRIADOS EM REGIME
    EXTENSIVO NO SUDESTE DO ESTADO DO PARÁ

  • Data: 22/05/2015
  • Mostrar Resumo
  • O estudo foi realizado em 12 propriedades, sendo que em todas foi realizado o estudo
    epidemiológico e em nove o estudo epidemiológico e exame clínico dos animais. Nos centros
    de manejo foram observados fatores favoráveis a traumatismos nos dígitos dos bovinos, como
    piso das seringas calçado com pedras, troncos com exposição de ferragens e rampas dos
    embarcadores com pisos de pedras pontiagudas, além da falta de manutenção e erros
    estruturais. Em todas as fazendas observou-se um manejo inadequado dos animais. Em 91,7%
    das fazendas (11/12) havia piquetes com presença de troncos de árvores e 66,7% (8/12)
    apresentavam áreas de relevo inclinado com presença de pedras; em 16,7% (2/12) das
    fazendas havia áreas de brejo com áreas alagadas. A sodomia foi relatada em todas as
    propriedades. Nenhuma fazenda adotava medidas profiláticas relacionadas às afecções podais.
    Foram examinados 498 bovinos entre fêmeas e machos. Os membros pélvicos foram mais
    acometidos, tanto nas fêmeas quanto nos machos. Foram diagnosticadas 629 lesões nas
    fêmeas, sendo as mais frequentes pododermatite séptica, deformações ungulares,
    pododermatite da sobreunha e dermatite digital. Nos machos diagnosticou-se 285 lesões e as
    mais frequentes foram pododermatite séptica, deformações ungulares e erosão de talão.
    Conclui-se que erros de manejo associados às condições inadequadas das instalações foram
    fatores que contribuíram para a ocorrência de enfermidades podais em bovinos de corte nas
    fazendas estudadas; as características ambientais favoreceram o desenvolvimento das lesões;
    as associações de lesões foram mais prevalentes do que as simples, sendo diagnosticadas em
    animais em todas as fazendas estudadas; o diagnóstico precoce a campo não é realizado, o que
    contribuiu para aumentar a gravidade e a diversificação das afecções podais diagnosticadas.

  • GERLANE NUNES NORONHA
  • A cadeia produtiva da pecuária de corte do município de Tailândia, estado do Pará: estrutura e caracterização sanitária dos abates

  • Data: 13/05/2015
  • Mostrar Resumo
  • O trabalho analisa a cadeia produtiva da pecuária de corte do município de Tailândia, Mesorregião Nordeste Paraense, Pará, onde a economia era oriunda da extração da madeira, porém hoje, apresenta pecuária de corte e leite em ascensão. O objetivo principal desta dissertação é caracterizar os principais elos da cadeia produtiva da carne e dar ênfase a etapa de abate e inspeção, que pode ser um estrangulamento para o desenvolvimento da bovinocultura de corte e escoamento de seus produtos. O diagnóstico contempla a avaliação de: produtores de diferentes níveis in loco; planilhas de abate, no período de março de 2010 a outubro de 2014; GTA’s (Guias de Trânsito Animal) e análises laboratoriais, para confirmação da principal causa de condenação de carcaças, a tuberculose bovina. As análises histopatológicas e molecular foram realizadas em Laboratórios da Universidade Federal Rural da Amazônia - UFRA e Instituto Evandro Chagas - IEC, com material coletado em matadouro frigorífico sob inspeção municipal. Ao obter resultados comprobatórios em questão, serão sugeridas medidas de controle que evitem a transmissão da tuberculose bovina e a redução dos prejuízos causados pela condenação de carcaças infectadas.

  • LILAINE DE SOUSA NERES
  • CADEIA PRODUTIVA DA PECUÁRIA LEITEIRA NO MUNICÍPIO DE
    TAILÂNDIA, ESTADO DO PARÁ: SISTEMAS DE PRODUÇÃO E TECNOLOGIA

  • Data: 23/04/2015
  • Mostrar Resumo
  • Esta dissertação visa caracterizar a cadeia produtiva da bovinocultura leiteira do município
    de Tailândia, Pará, Mesorregião Nordeste Paraense.  Foram avaliados  dados secundários
    em  sites governamentais e institucionais, e dados primários por meio de entrevistas com
    produtores, líderes comunitários e técnicos de instituições públicas. A cadeia produtiva do
    leite  sofreu mudanças  devido às alterações  na economia municipal, caracterizadas pela
    pressão na fiscalização ambiental e  inserção de  novas culturas agrícolas. A idade média
    dos produtores foi de 52,5 anos, com baixo nível de escolaridade e atuação na atividade há
    mais de dez anos. A produção de leite é a  principal atividade geradora de renda, entre
    outras de cunho rural e urbano. As propriedades utilizam sistema tradicional com reduzido
    uso de capineiras e suplementação alimentar. Como medidas sanitárias, há conformidade
    quanto à aplicação de vacina contra febre aftosa, sob controle e fiscalização da Agência de
    Defesa Agropecuária do Pará, além da prevenção contra parasitas e verminoses, entretanto,
    não há controle e planejamento reprodutivo. A ordenha é realizada manualmente em curral
    coberto, uma vez ao dia, e apenas 34,7% das propriedades possuem água encanada no local
    para higiene dos manipuladores, utensílios e animais. Devido à suspensão das atividades
    do laticínio municipal, a produção de leite e derivados é canalizada para o comércio
    informal, o que  configura um problema de saúde pública. As propriedades apresentavam
    médio nível tecnológico, o que reflete na produtividade animal, cuja média global foi de
    apenas 4,59 litros/vaca/dia. Nesse contexto, torna-se importante  que  políticas públicas
    promovam sistemas sustentáveis de produção, através da transferência de tecnologias, no
    desenvolvimento da produção de  leite e derivados, com certificação de qualidade e
    segurança alimentar, sem perder de vista a preservação da realidade social, econômica e
    cultural dos agricultores familiares.

  • MARCIA FRANCINELI DA CUNHA BEZERRA
  • Rotifera da Usina Hidrelétrica de Tucuruí-PA, Brasil

  • Data: 14/04/2015
  • Mostrar Resumo
  • O objetivo desta tese foi o estudo da variabilidade espacial e temporal da comunidade de rotíferos da Usina Hidrelétrica de Tucuruí-PA e o estado da arte da biodiversidade de rotíferos em reservatórios brasileiros. Para o estudo da variação espacial e temporal, foram filtrados 560 l de água, em uma rede de plâncton (60 µm), retirados do estrato 1 (superfície) e do 2 (oito metros), por meio de uma motobomba, em doze pontos distribuídos a montante (Zona Próxima a Barragem-ZPB e Zona de Transição-ZTR) e a jusante (Zona a Jusante), do reservatório, durante os períodos de maior (dez/11 e mar/12) e menor (set/11, jul/12 e set/12) precipitação de chuva. No primeiro período, foram realizadas coletas interanual e quadrimestrais, por meio de rede de plâncton (60 µm) na superfície da coluna d’água, em um total de 10 pontos amostrais, localizadas na zona limnética. No segundo, a coleta foi interanual e trimestrais, sendo realizada em diferentes estratos da coluna d’água (superfície-E1 e oito metros de profundidade-E2). As famílias Brachionidae, Lecanidae e Trichocercidae foram as mais representativas, em termos de frequência e abundância, nos dois períodos. As espécies Keratella americana e Rotaria sp. foram consideradas espécies mais abundantes, principalmente na Zona Próxima a Barragem (ZPB) e na de Transição (ZTR), respectivamente, com um padrão de distribuição, provavelmente mais afetada pela pluviosidade. Variações sazonais foram observadas entre na abundância das espécies, destas a K. americana e Rotaria sp. foram as que apresentaram maiores valores no período menos chuvoso e menores no mais chuvoso e outras ocorreram apenas em um dos períodos. No entanto, a correlação entre as abundâncias de espécies de rotíferos e variáveis limnológicas, durante o períodomais chuvoso, não foi significativa, mas foi no período mais chuvoso. Os altos valores dos eixos canônicos (Abundância de espécies de rotíferos vs variáveis limnológicas) foram influenciados pela transparência, condutividade e OD no E1, e pelo OD e pH no E2. Os maiores valores de diversidade foram apresentados na ZPB, no período mais chuvoso (mar/12) e na ZTR durante no menos chuvoso (set/12). A equitabilidade, entre as profundidades e entre as zonas, sugere menor variabilidade na abundância das espécies e maior riqueza. A composição, a abundância e a diversidade específica da comunidade de rotíferos da Usina Hidrelétrica de Tucuruí podem ser afetadas pelas variações morfométricas e limnológicas do local de coleta e pela pluviosidade. Para o Estado da Arte foram realizados levantamentos bibliográficos, artigos indexados, sobre a biodiversidade de rotíferos planctônicos, em reservatórios brasileiros. A maioria dos trabalhos aborda, principalmente, os temas: distribuição horizontal, composição e riqueza, seguidas de distribuição vertical, de densidade, de aspecto sazonal e temporal, de abundância relativa e de diversidade e equitabilidade. A maior parte dos reservatórios está localizada na região Sudeste, com a maior riqueza, contando o número total de espécies (incluindo as repetidas nos diferentes artigos) e na Nordeste, com menor número de reservatório e com a menor riqueza. A região Centro-Oeste apresentou a maior riqueza e a Nordeste a menor (apenas espécies e subespécies não repetidas). Percebe-se, portanto, que há um esforço cada vez maior dos autores das regiões Sudeste e Centro-Oeste na identificação ao menor nível taxonômico possível. As espécies Keratella americana e Conochilus unicornis foram as mais comuns em todas as regiões brasileiras, seguidas de K. lenzi, Polyarthra vulgaris, Brachionus falcatus e Filinia longiseta, consideradas cosmopolitas. Portanto, as espécies da comunidade de rotíferos se distribuem heterogeneamente e apresentam diferenças consideráveis em sua distribuição vertical e horizontal, nos ambiente do reservatório da UHE Tucuruí, podendo ser afetadas pelas variações morfométricas e limnológicas do local de coleta e pela pluviosidade. Portanto, os rotíferos possuem ampla distribuição em todas as regiões brasileiras, devendo-se à capacidade de habitarem variados cursos hídricos e de se dispersarem, por meio de ovos de resistência presos a diferentes organismos ou embarcações.

  • ANDRÉ LUIZ ALVES DE SÁ
  • Utilização de Células de Trofoblasto de Embriões Partenogenéticos na Descrição de Haplótipos de BOLA-DRB3-DOA-DOB

  • Data: 30/03/2015
  • Mostrar Resumo
  • A diversidade do Complexo Principal de Histocompatibilidade (MHC) bovino, conhecido como BoLA (Bovine Leukocyte Antigens), foi estudada inicialmente usando variantes sorológicas ou sequenciamento de alguns de seus genes. A maioria dos bovinos são heterozigotos em BoLA e apenas em ocasiões especiais (animais homozigotos ou que possuam informação de pedigree) seu haplótipo pode ser caracterizado. Portanto, este trabalho objetivou desenvolver uma nova abordagem para descrever haplótipos de BoLA de vacas heterozigotas, utilizando células do trofoblasto de embriões partenogenéticos bovinos. Embriões partenogenéticos foram produzidos utilizando protocolo de ativação de oócitos padrão e suas células do trofoblasto foram cultivadas para extração do DNA. Dois métodos para validação desta abordagem foram utilizados: um painel de 445 SNPs em BoLA foi informativo acerca do efeito que a recombinação meiótica apresenta na zigose da região; e a comparação de alelos de BoLA-DRB3 entre a fêmea bovina e sua célula trofoblástica partenogenética (CTP) demonstrou ser um método confiável e prático para a investigação de homozigose em BoLA. A partir de ambos os métodos, a metodologia desenvolvida aqui foi validada, já que CTPs homozigotas em BoLA foram derivadas de vacas heterozigotas, permitindo a descrição de haplótipos de BoLA. A análise detalhada da região de Classe IIa de BoLA-DRB3-DQA-DQB revelou a presença de 18 haplótipos distintos, sendo 16 destes nunca antes descritos. Além disso, dois alelos de DQA e um de DQB presentes nestes haplótipos são novos. O método descrito aqui foi mais eficiente do que a investigação por fêmeas homozigotas ou inferir a composição haplotípica baseada em informação de pedigree, além de evitar ambiguidades nos resultados. Novas pesquisas buscando a otimização deste método pode aumentar a sua eficiência e torná-lo mais facilmente aplicável a uma variedade de estudos genéticos, usando espécies diferentes e com finalidades distintas.

  • ARILSON MORAES CARDOSO
  • Adição do farelo de crambe na ensilagem de capim-elefante

  • Data: 27/03/2015
  • Mostrar Resumo
  • Avaliou-se a composição químico-bromatológica e microbiológica das silagens de capim-elefante contendo doses crescentes de farelo de crambe (FC). Foram utilizados 48 silos experimentais em delineamento inteiramente casualizado (DIC), em esquema fatorial com 4 doses de inclusão de farelo de crambe (0, 10, 20 e 30%) em relação à matéria natural do capim, e 3 graus de massa especifica (ME) (400 500 e 600 kg de MV/m3), com 4 repetições. Após 140 dias os silos experimentais foram abertos e retiradas amostras para determinação do teor de matéria seca matéria seca (MS), proteína bruta (PB), extrato etéreo (EE) fibra em detergente neutro corrigidos para cinzas e proteína (FDNcp), fibra em detergente ácido (FDA), hemicelulose (HEM), lignina (LIG), carboidratos totais (CT) e carboidratos não fibrosos (CNF), nitrogênio insolúvel em detergente neutro (NIDIN/NT),potencial hidrogênio (pH), nitrogênio amoniacal (N-NH3), Bactérias ácidos láticas (BAL), fungos filamentosos (FUN) leveduras (LEV). Os tratamentos foram analisados por regressão linear múltipla através do software R. Considerando significativo ao nível de 5% de probabilidade (P<0,05)pelo método dos mínimos quadrados Para a massa especifica, somente para as variáveis MM e LEV observou-se efeito significativo (P<0,05). Para as variáveis MS, PB, FDNcp, FDA, HEM, LIG, NIDN, CNF, BAL e CT observou-se efeito (P<0,05) para o nível de inclusão do farelo de crambe. Para a interação dos fatores (massa especifica x doses de inclusão) observou-se efeito para pH e N-NH3, A variável EE não sofreu efeito (P<0,05) de tratamentos. A adição do farelo de crambe na ensilagem capim-elefante promoveu melhorias na composição bromatológica, uma vez que houve elevação nos teores de MS, PB, CNF, além de redução nos componentes fibrosos (FDNcp e FDA), proporcionando assim um alimento de boa qualidade. A massa especifica referente a 600 Kg de MV/m³ apesentou melhor resultado reduzindo o pH, N-NH3 e a população de LEV. FC pode ser utilizado como aditivo de absorção de umidade na silagem de capim-elefante.

  • JORGE CARDOSO DE AZEVEDO
  • RESÍDUOS DA AGROINDÚSTRIA DE FRUTAS COMO ADITIVOS PARA ENSILAGEM DE CAPIM ELEFANTE

  • Data: 27/03/2015
  • Mostrar Resumo
  • Objetivou-se com este trabalho avaliar o potencial de utilização de resíduos da agroindústria de fruticultura (banana, manga e maracujá) como aditivos absorventes de umidade na ensilagem de capim-elefante (Pennisetum purpureum) cultivar Napier, sob diferentes massas específicas, determinando seu efeito na qualidade fermentativa, características microbiológicas e composição bromatológica. O delineamento experimental utilizado foi interiamente casualisados, com quatro repetições, em esquema fatorial 4 x 3, sendo composto por testemunha, , resíduo de banana (RB), resíduo de manga (RMg); e resíduo de maracujá (RMj) e três massas específicas (400, 500 e 600 kg MV/m3). Após 240 dias de fermentação os silos experimentais foram abertos e retiradas amostras para determinação do teor de matéria seca matéria seca (MS), proteína bruta (PB), extrato etéreo (EE) fibra em detergente neutro corrigidos para cinzas e proteína (FDNcp), fibra em detergente ácido (FDA), hemicelulose (HEM), lignina (LIG), carboidratos totais (CHOT) e carboidratos não fibrosos (CNF), nitrogênio insolúvel em detergente neutro (NIDIN/NT), nitrogênio insolúvel em detergente ácido (NIDA/NT), potencial hidrogênio (pH), nitrogênio amoniacal (N-NH3), bactérias ácidos láticas (BAL), fungos filamentosos (FUN) e leveduras (LEV). Os tratamentos foram analisados através do software R, considerando significativo ao nível de 5% de probabilidade (P<0,05). Para comparação das médias de cada tratamento, quando esta influenciou a variável resposta, foi adotado o teste de Tukey de 5% de significância. O efeito da massa específica no silo é mais efetivo na silagem exclusiva de capim-elefante, onde a compactação de 600 kg /m3 contribui para melhorias no processo fermentativo, microbiológico. A massa específica exerce pouco efeito sobre a composição bromatológica A adição do resíduo de banana na ensilagem do capim-elefante promoveu melhorias apenas na composição bromotológica, elevando os teores de MS, PB, CNF e redução nos componentes fibrosos (FDNcp e FDAcp), porém não favorece o processo fermentativo e microbiológico. A adição de subprodutos de maracujá e manga promove o aumento da MS e favorece o processo fermentativo, microbiológico e bromatológico da silagem, independente da massa específica.

  • MÁRCIA VALÉRIA SILVA DO COUTO
  • SANIDADE DE JUVENIS DE Arapaima gigas(CUVIER, 1829) DESAFIADOS COM AeromonashydrofilaAPÓS SUPLEMENTA

  • Data: 27/02/2015
  • Mostrar Resumo
  • Com este trabalho objetivou-se avaliar os efeitos da utilização de Lactobacillusplantarum sobre os aspectos sanitários de Arapaima gigas desafiados com Aeromonashydrophila. Para tanto, foram conduzidos três experimentos em delineamento inteiramente casualizado constituídos de três tratamentos: sintomatologia e letalidade (0, 104, 106 e 108 UFC/mL), dose letal (109 UFC/mL) e dose subletal (106 UFC/mL) utilizando peixes alimentados com ração comercial, ração aspergida de MRS broth, 106 e 108 UFC/mL de L. plantarum. No primeiro experimento os animais apresentaram mortalidade de 33,33% e 100% nas concentrações de 106 e 108UFC/ml de Aeromonas, em até 25h, apresentando sinais clínicos como escurecimento da pele; ulceração; congestão; palidez do fígado e brânquias; pontos hemorrágicos na pele; e pouca alteração imunológica. Os peixes injetados com 109 UFC/mL apresentaram maior número de alterações no hemograma e mortalidade de 100% em peixes não alimentados com bactéria láctica. Os pirarucus do experimento segundo experimento não apresentaram mortalidades. Apesar disso, mostraram respostas a infecções externas e hematológicas. No fígado, foram encontrados: hiperemia, desarranjo cordonal, deformação e rompimento do contorno celular, necrose e degeneração lipídica, sendo que, a maior concentração de probiótico apresentou a menor quantidade de alterações no fígado. De modo geral, os peixes alimentados com probiótico apresentaram melhores resultados diante a infecção, recomendando-se o uso da dosagem 108 UFC/mL, tendo em vista os resultados de mortalidade associados a hematologia, histologia e índices hepato e esplenossomático.

  • NATALINO DA COSTA SOUSA
  • Desempenho produtivo e hematologia de Arapaima gigas alimentados com probiótico

  • Data: 27/02/2015
  • Mostrar Resumo
  • A intensificação da produção de espécies nativas vem se expandido e novas estratégias estão sendo criadas para melhorar a sanidade dos organismos e aumentar a sua produtividade. Logo, o presente trabalho objetivou-se avaliar o desempenho zootécnico e os parâmetros hematológicos de alevinos de Arapaima gigas alimentados com dietas suplementadas com Lactobacillus plantarum. O experimento teve 68 dias de duração com duas biometrias, uma aos 32 dias e outra aos 68 dias. Noventa e seis peixes foram distribuídos em 12 tanque-redes com volume de 1m³ realizando um delineamento inteiramente casualizado com 3 repetições e 4 tratamentos (RC: ração controle; RCM: ração controle com MRS; R106: ração com probiótico 106 UFC.g-1 e R108: ração com probiótico 108 UFC.g-1). Na última biometria, além da coleta de sangue e mensuração de peso e comprimento, seis peixes de cada tratamento foram eutanásiados para a contagem de bactérias totais e ácido lácticas, assim como as análises de parasitas. O desempenho zootécnico do pirarucu apresentou valores de sobrevivência e uniformidade maiores no tratamento R108 com a menor conversão, assim como, maiores concentrações de bactérias ácido lácticas e menores concentrações de bactérias totais nos tratamentos com probiótico em relação aos controles. Foram observados aumento de prevalência e intensidade média de Trichodina sp. nos tratamentos controles, que possivelmente pode ter ocasionado a mortalidade de alguns espécimes. Em relação aos parâmetros hematológicos, foram observados aumento de hematócrito (%) no tratamento R108 e eritrócitos nos dois tratamentos com probióticos, assim como a contagem de trombócitos. Os leucócitos totais foram maiores no tratamento R108, seguido pelo aumento de monócito e neutrófilo, visto que não houve diferença nos linfócitos entre os tratamentos. Portanto, o L. plantarum apresenta potencial probiótico, aumentando a sobrevivência, modificando a microbiota intestinal e melhorando o sistema imunológico do pirarucu.

  • DANUZA LEITE LEÃO
  • Criopreservação do sêmen de macaco-prego (Sapajus apella Linnaeus, 1758): avaliação de diferentes diuidores, glicerol e antioxidante.

  • Data: 24/02/2015
  • Mostrar Resumo
  • O objetivo do presente trabalho foi aprimorar a biotecnologia de criopreservação de sêmen para a espécie Sapajus apella, estabelecendo um protocolo eficiente para a manutenção da viabilidade espermática, comparando o desemprenho dos diluidores TES-TRIS, ACIN e ACP-118® para escolher do melhor diluidor durante a dissolução do coágulo seminal e resfriamento, para posteriormente ser estabelecido a melhor concentração de glicerol (3; 5 e 7%) a ser adicionado no diluidor, bem como avaliar a a suplementação do antioxidante catalase (10 μg e 50 μg) no meio de congelação seminal, no intuito de melhorar os parâmetros espermáticos. Foram utilizados seis machos adultos de S. apella oriundos do Centro Nacional de Primatas. As coletas do sêmen foram realizadas por eletroejaculação com probe retal, após a contenção química dosanimais com Cloridrato de Ketamina e Cloridrato de Xilazina. Na primeira fase do projeto, o sêmen obtido foi diluído em TES-TRIS, ACIN e ACP®-118, mantido em banho-maria a 37 °C. Após dissolução do coágulo, o sêmen foi resfriado em geladeira a 4°C por 90 minutos, e avaliadas após 28h quanto a motilidade, o vigor, e o percentual de integridade de membrana antes e após o resfriamento. ACP®-118 foi o melhor diluidor para preservar a motilidade dos espermatozoides e viabilidade após 28 horas de incubação. A partir desse resultado, realizada a criopreservação avaliando diferentes concentrações de glicerol (3, 5 e 7%). Os espermatozoides criopreservados a 3% de glicerol, apresentaram melhores parâmetros espermáticos, seguido da fecundação in vitro. Na segunda fase do projeto, foi realizada criopreservação do sêmen de S. apella em diluidor ACP®-118 suplementado ou não com antioxidante catalase (10μg/mL e
    50μg/mL). Todos os diluidores foram igualmente eficazes na manutenção de parâmetros do espermáticos, entretanto o grupo catalase 50μg, foi o que melhor manteve o vigor durante cada etapa da criopreservação (resfriado e descongelação), e a funcionalidade de membrana plasmática após a descongelação espermática. Em conclusão, ACP-118® pode ser usado de forma eficiente como diluidor para a criopreservação de sêmen S. apella adicionado de 3% de glicerol, além de que a adição do antioxidante catalase mostrou efeito benéfico durante esse processo.

  • NATALIA DA SILVA E SILVA SILVEIRA
  • PERIODONTITE EM OVINOS NO ESTADO DO PARÁ: ETIOLOGIA, ASPECTOS
    EPIDEMIOLÓGICOS E CLÍNICO-PATOLÓGICOS

  • Data: 29/01/2015
  • Mostrar Resumo
  • O presente trabalho relata os aspectos epidemiológicos, clínico-patológicos e
    bacteriológicos do primeiro registro de periodontite em ovinos no Brasil, ocorrido em uma
    propriedade rural no município de Benevides, Pará. O surto ocorreu aproximadamente um
    mês após o pastejo na área de Panicum maximum cv. Massai, a qual sofreu práticas agrícolas,
    quando foi observado aumento de volume na mandíbula em alguns animais, em sua maioria
    com idade acima de 36 meses. Foi realizado o exame  clínico extra-oral dos 545 ovinos e
    verificou-se aumento de volume da mandíbula em 3,7%. Os animais acometidos
    apresentavam baixo escore corporal, pelos arrepiados e sem brilho, alguns com afrouxamento
    e perda dos dentes pré-molares e molares inferiores e superiores, formação de abscesso e
    fístula no local acometido, demonstração de dor à palpação e dificuldade de mastigação. Das
    39 cabeças de animais jovens analisadas no exame macroscópico  post-mortem, 51,3%
    apresentavam lesões periodontais e das 38 analisadas após a maceração, 73,7% também
    apresentavam lesões. Das cabeças com lesões no exame  post-mortem, em 45% as lesões
    encontravam-se na maxila, 15% na mandíbula e 40% nas duas estruturas (maxila e
    mandíbula). Nas cabeças com lesões após a maceração, 50% encontravam-se na maxila e 50%
    na maxila e mandíbula. Das 17 cabeças de animais adultos analisadas no exame post-mortem
    e após a maceração, todas apresentavam lesões periodontais. No exame post-mortem, 11,8%
    apresentavam lesões na mandíbula e 88,2% nas duas estruturas; após a maceração, 5,9% na
    maxila, 11,8% na mandíbula e 82,3% nas duas estruturas. Os achados histopatológicos
    revelaram processo inflamatório piogranulomatoso. Para caracterização da microbiota
    bacteriana subgengival de 14 ovinos com periodontite foi realizada a Reação em Cadeia da
    Polimerase (PCR) para pesquisa de micro-organismos pertencentes ao complexo vermelho de
    Socransky (Porphyromonas gingivalis, Tannerella forsythia e Treponema denticola) e outros
    possíveis periodontopatógenos Gram-negativos e Gram-positivos. Em 50% das amostras foi
    possível identificar Porphyromonas gingivalis, em 92,8% Tannerella forsythia  e em 78,5%
    Treponema denticola. Os três periodontopatógenos pertencentes ao complexo vermelho
    ocorreram concomitantemente em 42,8% das amostras.  Foram identificados ainda em pelo
    menos um animal examinado  Campylobacter rectus,  Eikenella corrodens,  Enterococcus
    faecium,  Fusobacterium nucleatum,  Prevotella intermedia,  Prevotella loeschii e  Prevotella
    nigrescens. Não foram detectados nas 14 amostras Aggregatibacter actinomycetemcomitans,
    Dialister pneumosintes,  Enterococcus faecalis e  Porphyromonas gulae. Os resultados
    permitem concluir que a periodontite ovina ocorrida no município de Benevides – PA possui etiologia infecciosa e acometeu um significativo número de animais, diversos com
    abaulamento da mandíbula; teve alta incidência nos  jovens e envolveu a totalidade dos
    animais adultos examinados post-mortem e após a maceração.

2014
Descrição
  • NATHALIA NOGUEIRA DA COSTA DE ALMEIDA
  • EFEITO DO CORTISOL NA PRODUÇÃO IN VITRO DE EMBRIÕES BOVINOS

  • Data: 19/12/2014
  • Mostrar Resumo
  • A Pecuária é um dos setores que tem colocado a região Amazônica no centro das discussões em relação às questões ambientais. Portanto, é necessário o desenvolvimento de ações que promovam o aumento da produtividade do rebanho, sem que seja necessária a abertura de novas áreas de pastagens. O emprego de biotecnologias, como a produção in vitro de embriões (PIVE), poderá contribuir para aumentar a produtividade do rebanho diminuindo com isso a pressão ambiental. Nesse sentido o presente projeto se propõe a aperfeiçoar os meios de cultivo, visto que a qualidade do embrião produzido in vitro é inferior ao in vivo. Há evidencias da metabolização do cortisol em oócitos e em células da placenta, indicando que o referido hormônio tem função sobre os processos de ovulação e desenvolvimento fetal, respectivamente. Sendo assim esta revisão tem como objetivo avaliar a contribuição dos hormônios glicocorticoides na reprodução animal, em especial na produção in vitro de embriões bovinos.

  • TATIANE TELES ALBERNAZ FERREIRA
  • Detecção molecular do Vírus da Imunodeficiência Bovina (BIV) em búfalos (Bubalus
    bubalis) no estado Pará

  • Data: 12/12/2014
  • Mostrar Resumo
  • A imunodeficiência viral bovina é uma doença crônica e progressiva causada por um
    lentivírus que acomete bovinos e bubalinos. Embora a infecção seja relatada em bovinos em
    vários países do mundo, inclusive no Brasil, em bubalinos só existem dois relatos da infecção,
    um no Paquistão e outro no Camboja. Diante disso o objetivo desse trabalho foi verificar a
    ocorrência do vírus da imunodeficiência bovina (BIV) em búfalos provenientes do estado do
    Pará, região Norte do Brasil. Para verificar a ocorrência do BIV no rebanho foi feita a
    detecção do DNA proviral em 607 amostras de sangue de búfalos obtidas de 10 propriedades
    do estado do Pará, por meio da reação em cadeia da  polimerase -  semi-nested  (PCR-SN)
    utilizando-se  primers específicos para a região  pol do genoma do vírus. Das 607 amostras
    testadas na PCR-SN para o BIV, 27 (4,4%) foram positivas. As sequências amplificadas
    foram confirmadas por clonagem e sequenciamento de  nucleotídeos. A similaridade da
    sequência de nucleotídeos das amostras isoladas com a estirpe de referência (R-29) foi de
    99%. Epidemiologicamente, este estudo fornece dados iniciais importantes, que revelam a
    primeira detecção no Brasil da presença do BIV em bubalinos e alertando sobre a
    possibilidade do vírus funcionar como um fator de risco para a saúde das populações de
    bubalinos e um potencial agente causador de doença crônica.

  • NAYRA FERNANDA DE QUEIROZ RAMOS FREITAS
  • Prevalência da anemia infecciosa equina na Ilha de Marajó, estado do Pará, Brasil

  • Data: 12/12/2014
  • Mostrar Resumo
  • O objetivo do estudo foi verificar a prevalência da anemia infecciosa equina nos municípios
    de Cachoeira do Arari, Salvaterra, Santa Cruz do Arari e Soure, Ilha de Marajó, estado do
    Pará, Brasil. Para a pesquisa sorológica foram selecionadas 349 amostras, coletadas no
    período de outubro de 2012 a março de 2013 e testadas pela imunodifusão em gel de ágar. Em
    65 amostras foi realizado hemograma e em 70 exame bioquímico, no qual se pesquisou ureia,
    creatinina,  aspartato aminotransferase, alanina aminotransferase, gama glutamiltransferase
    fosfatase alcalina, bilirrubina total e bilirrubina direta. Foi verificada uma prevalência de
    24,06% (84/349). O número médio de hemácias foi significativamente menor nos animais
    soropositivos em relação aos soronegativos e não houve diferença significativa nos resultados
    médios de hematócrito, hemoglobina, volume globular médio, concentração de hemoglobina
    globular média, plaquetas, no leucograma,  assim como no exame bioquímico. O quadro
    clínico observado foi estado nutricional ruim, apatia, mucosas pálidas, desidratação, além de
    elevação nas frequências cardíaca e respiratória. Na necropsia as principais alterações
    encontradas em todos os equinos foram carcaça ictérica, pequeno acúmulo de líquido na
    cavidade abdominal, assim como hepato e esplenomegalia. O exame histopatológico
    demonstrou baço e fígado com hemossiderose. A anemia infecciosa equina é endêmica nos
    municípios estudados.

  • SARAH RAPHAELLA ROCHA DE AZEVEDO SCALERCIO
  • Análise imunohistológica e desenvolvimento folicular após auto-transplante de tecido
    ovariano de macaca de cheiro Saimiri collinsi

  • Data: 11/12/2014
  • Mostrar Resumo
  • O objetivo deste trabalho foi estudar a foliculogênese ovariana de Saimiri sciureus. 
    Para tanto, foi avaliada a expressão de fatores intra-ovarianos ligados ao desenvolvimento, 
    inibição folicular e proliferação celular, além da investigação dos efeitos do pré-tratamento 
    com o análogo da vitamina E, Trolox, sobre a viabilidade e funcionalidade folicular, índice 
    de apoptose, proliferação celular, vascularização e fibrose, após o auto-transplante do tecido 
    ovariano fresco. Foi possível imunolocalizar pela primeira vez a expressão das proteínas: fator 
    crescimento e diferenciação-9 (GDF-9), c-Kit/Kit Ligante e Ki-67 e confirmar a expressão do 
    hormônio anti-mülleriano (AMH) em diferentes fases do desenvolvimento folicular de 
    macaco de cheiro. No que diz respeito a pré-incubação com o antioxidante Trolox, pôde-se 
    observar uma melhora na sobrevivência folicular após o autotransplante, diminuição da taxa 
    de apoptose em células do estroma, porém, aumento nas áreas de fibrose no tecido. Os nossos 
    resultados sugerem que o tecido ovariano fresco pode ser incubado e enxertado sem grande 
    impacto sobre o crescimento folicular precoce e a morfologia após auto-transplante 
    subcutâneo por curto período. Acreditamos que nossos resultados oferecem uma contribuição 
    importante para a compreensão do processo de foliculogênese em macacos neotropicais. Este 
    conhecimento é uma ferramenta importante para avaliar a viabilidade folicular e 
    funcionalidade após a criopreservação, transplante de tecido ovariano e cultivo in vitro de 
    folículos pré-antrais, em especial para os animais com risco de extinção e às mulheres com
    risco de perda de fertilidade devido à quimioterapia e radioterapia.

  • FRANCISBERTO BATISTA BARBOSA
  • Avaliação de três tipos de suplementação mineral em bovinos de corte em uma
    propriedade no nordeste do estado do Pará

  • Data: 10/12/2014
  • Mostrar Resumo
  • Em uma propriedade localizada na região nordeste do estado do Pará foram analisadas alternativas de suplementação mineral em bovinos de corte, da raça nelore, machos, com idades entre 18 e 20 meses e pesos de 299,5 a 308,5 Kg, com o objetivo de se avaliar qual mistura obteve melhor custo benefício e avaliar os minerais no fígado e osso. O estudo foi realizado por cinco meses no período de ótima oferta de pastagem na região, de março a agosto de 2012, foram utilizados 60 bovinos, divididos em três grupos de 20 animais, o grupo 1 recebeu uma mistura mineral seletiva (MMS), composta por 25kg de NaCl e 50kg de fosfato bicálcico (9kg de fósforo), acrescido de 190g de sulfato de Cu (47,5g de Cu) e 60g de sulfato de Co (15g de Co); o grupo 02 apenas cloreto de sódio ; e o grupo 03 uma mistura mineral comercial (MMC) (25kg de NaCl, 6,5kg P, 10,7 a 11,5kg Ca, 1,8kg S, 900g Mg, 300g Zn, 75g Cu, 100g Mn, 10g Co, 4,5g I, 1,8g Se, 65g F). Os resultados demonstraram um melhor custo benefício para a mistura mineral seletiva, que a pastagem não foi suficiente para atender a necessidade de Co dos animais e que, a pastagem foi suficiente para atender as necessidades de P, Cu, Zn e Se durante cinco meses.

  • HENRIQUE DOS ANJOS BOMJARDIM
  • Estudo das deficiências minerais em vacas em lactação da bacia leiteira do município de Rondon do Pará, estado do Pará

  • Data: 10/12/2014
  • Mostrar Resumo
  • Realizou-se um estudo das deficiências minerais em vacas em lactação de rebanhos leiteiros pertencentes a 13 propriedades da bacia leiteira do município de Rondon do Pará, estado do Pará. Foram determinados os níveis de fósforo (P), densidade específica e porcentagem de cinzas no osso, e os níveis de cobre (Cu), cobalto (Co), selênio (Se), zinco (Zn), ferro (Fe) e manganês (Mn) no fígado de 47 vacas leiteiras no 2º terço da lactação. Estas amostras foram coletadas por meio de biópsias realizadas no terço superior da 12ª costela do lado direito e no bordo caudal do lobo caudado do fígado, respectivamente. Os rebanhos eram formados por animais mestiços (Holandes x Zebu), mantidos em sistema de produção extensivo em pastos de Brachiaria brizantha cv Marandu e recebiam suplementação mineral. A mistura mineral em 12 propriedades era do tipo comercial, dita “completa”, acrescida de quantidades de NaCl acima do recomendado pelos fabricantes em dez propriedades. Em sete propriedades as misturas minerais eram fornecidas em cochos sem cobertura e em oito, o fornecimento da mistura mineral não era realizado diariamente. Em 11 propriedades, havia históricos clínicos condizentes com deficiências minerais nos rebanhos. Nessas fazendas a retenção de placenta e a osteofagia foram as alterações mais relatadas. Foi observado deficiência de P em cinco propriedades, de Co em duas propriedades, de Se e Zn em oito propriedades. Conclui-se que as deficiências de P, Se e Zn ocorreram em maior proporção e a de Co em menor proporção e que a suplementação mineral realizada na maioria das propriedades não atendeu as exigências diárias de P, Se e Co, baseadas no consumo estimado de 30 g de NaCl/animal/dia e que os cochos pouco adequados ou inadequados para a suplementação, assim como o fornecimento inconstante das misturas minerais contribuíram para a deficiência de um ou mais minerais.

  • LUCIANO LEITE PEREIRA
  • Influência da estação do ano na eficiência da transferência de embrião em fêmeas nelores na região oeste do estado do Pará.
  • Data: 25/11/2014
  • Mostrar Resumo
  • O presente trabalho busca mostrar a evolução das tecnologias envolvidas na Produção In Vitro de Embriões (PIVE) em fêmeas bovinas da raça Nelore e em fêmeas bubalinas da raça Murrah, nas estações mais chuvosa e menos chuvosa, visando identificar a possível influência dessas estações sobre a prática da PIVE, utilizando o cromo orgânico a fim de tentar amenizar possiveis condições de estresse causados pelas condições climáticas. O estudo objetivou o melhoramento genético do rebanho da região para melhorar a sustentabilidade do homem na terra. Para a seleção das doadoras de embriões será utilizado o equipamento de ultrassongrafia portátil veterinário, sendo utilizado tambem para guiar a fase de aspiração folicular, sendo um dos equipamentos que ajudou a tornar a tecnologia de PIVE mais difundida, posto que facilita a aspiração do folículos com o animal vivo e sem a utilização de tecnologias que necessitam de cirurgia. Foram coletadas informações sobre clima da região, como temperatura e umidade do ar, utilizando informações do BDMEP-INMET, através de equipamentos metereológicos; da mesma forma dados relativos ao material utilizado no processo biotecnológico de embriões; e também dados laboratoriais de exames sanguíneos, que sofrem interferência do estresse e do fornecimento do cromo. Todos esses dados foram tabulados e analisados estatisticamente pelas ferramentas computacionais GLIMMIX e GUIDED DATA ANALYSIS do SAS versão 9.3. Neste artigo, podemos verificar vários aspectos evolutivos das tecnologias da PIVE, e que essa evolução ajuda a tornar o Brasil, o maior produtor de embriões provenientes de fecundação in vitro, o que faz com que nosso país consiga cada vez mais evoluir em pesquisas para melhorar cada vez mais essa técnica de biotecnologia da reprodução animal, apesar de mais concentrada na região sudeste do Brasil.
     
     
  • MARIA CRISTINA MANNO
  • Emulsificante em rações com óleo de palma na alimentação de frangos de corte

  • Data: 21/11/2014
  • Mostrar Resumo
  • Com o objetivo de verificar o poder emulsificante de produto comercial à base de lisolecitina de soja (50%) sobre diversas fontes lipídicas comumente utilizadas na avicultura industrial, e sobre o desempenho, metabolismo, parâmetros séricos e rentabilidade da produção de frangos de corte, foram conduzidos três experimentos. O primeiro ensaio foi conduzido in vitro utilizando como fontes lipídicas amostras de óleo bruto de soja, óleo de palma, óleo de peixes, óleo de vísceras de frango e sebo bovino. Foi realizada a caracterização do perfil graxo por meio de cromatografia gasosa, e a composição dos óleos e gorduras foi correlacionada com o índice de emulsificação apresentado em duas temperaturas, aos 25°C e aos 41°C. O índice de emulsificação foi realizado com a inclusão de solução biossurfactante (água e lisolecitina de soja) em quatro proporções distintas: 0,25; 0,50; 0,75 e 1,00 mg.L-1. A atividade emulsificante de gorduras (lisolecitina de soja) foi observada durante 72 horas. No segundo experimento, foram alojados 1250 pintos de 1 dia machos, em 50 boxes com 25 aves/boxe, distribuídos em delineamento em blocos ao acaso com cinco tratamentos e dez repetições. Os tratamentos consistiram em: ração controle (T1), ração com redução de 50kcal/kg de EM em relação do T1 (controle negativo) (T2), ração com redução de 100kcal/kg de EM em relação do T1 (controle negativo) (T3), ração T2 com inclusão de 0,025% de lisolecitina de soja (T4), ração T3 com inclusão de 0,050% de lisolecitina de soja (T5). Foram avaliados os índices de desempenho dos animais (peso, consumo de ração, conversão alimentar, mortalidade) semanalmente, sendo aos 42 dias calculado o fator de produção (FEP). Ao final do experimento foram abatidas cem aves, dois animais por boxe, para avaliação de rendimento de carcaça e vísceras. Amostras foram analisadas em laboratório para determinação da deposição de proteína e gordura na carcaça. Aos 40 dias de idade também foram avaliados os parâmetros séricos relacionados ao metabolismo de gordura (VLDL, LDL, HDL, Triglicerídeos e Colesterol). No terceiro ensaio, foram alojados 320 pintos de 14 dias machos, em 40 gaiolas com 8 aves/gaiola, distribuídos em delineamento inteiramente ao acaso com cinco tratamentos e oito repetições. Os animais passaram por cinco dias de adaptação às gaiolas e cinco dias de coleta total de excretas. Os cinco tratamentos utilizados no experimento anterior foram mantidos. Foram avaliados os coeficientes de digestibilidade da matéria seca, da proteína bruta, da gordura, das fibras em detergentes neutro e ácido dos animais, bem como estimada a energia metabolizável aparente e aparente corrigida para nitrogênio das aves nos diferentes tratamentos. Com base nos resultados do ensaio de desempenho, foram levantados os custos com a ração, aquisição do pintinho de um dia já vacinado e receita com a venda dos animais para o cálculo do Custo Operacional Efetivo (COE), a Receita Bruta (RB), e Margem Bruta em relação ao COE (MBCOE), o Ponto de Nivelamento (PN), o Lucro Operacional Efetivo (LOE) e o Índice de Lucratividade (IL). A lisolecitina apresentou bons índices de emulsificação aos 25oC em fontes lipídicas oleosas com altas concentrações de ácido graxo saturado, o que não necessariamente se repete aos 41oC, temperatura do interior do organismo das aves, quando o fator determinante passa a ser o teor de ácidos graxos insaturados do material utilizado na alimentação de frangos de corte. O efeito da lisolecitina foi nulo em ambas as temperaturas sobre o sebo bovino, não propiciando melhora do índice de emulsificação aos 25oC ou aos 41oC. Não houve diferença significativa nos parâmetros de desempenho, rendimento de carcaça e vísceras e parâmetros séricos de frangos de corte submetidos à adição de lisolecitina de soja nas rações contendo óleo de palma. Não houve influência da adição de lisolecitina às rações sobre os coeficientes de digestibilidade da matéria seca, proteína bruta, gordura, fibra em detergentes neutro e ácido, e energia bruta. Houve influência dos níveis de energia das rações sobre os coeficientes de digestibilidade de proteína bruta, fibras em detergentes neutro e ácido e energia bruta, bem como sobre os valores de energia metabolizável aparente e energia metabolizável aparente corrigida para nitrogênio das rações. A utilização de lisolecitina de soja com emulsificante de rações não traz redução de custo associado à sua utilização na dieta para frangos de corte. O índice de lucratividade não foi influenciado pela inclusão de lisolecitina nas rações das aves, entretanto o mesmo apresenta-se maior em rações de baixa densidade energética na alimentação de frangos de corte em clima quente.

  • JAIME RIBEIRO CARVALHO JUNIOR
  • A ETNOICTIOLOGIA DE PESCADORES XIKRIN DA TERRA INDÍGENA
    TRINCHEIRA BACAJÁ – PARÁ, BRASIL

  • Data: 13/10/2014
  • Mostrar Resumo
  • Esta tese foi desenvolvida em cinco aldeias da comunidade indígena Xikrin-Mẽbêngôkre, que
    habitam a Terra Indígena Trincheira Bacajá – TITB, Pará, Brasil. O objetivo geral foi
    analisar, por meio da etnoictiologia, os diversos aspectos ecológicos, cognitivos e
    comportamentais dos pescadores, visando entender as interações básicas que essa comunidade
    mantém com os recursos pesqueiros e outros elementos dos ecossistemas existentes na TITB.
    Com as devidas autorizações, conduzimos a pesquisa entre os meses de abril de 2011 a abril
    de 2013, em sete excursões a cinco aldeias, totalizando 153 dias. As informações foram
    obtidas por meio de abordagens etnobiológicas e etnoecológicas empregando um conjunto de
    métodos relacionados à pesquisa participativa. Participaram deste estudo 103 indígenas com
    idades entre 15 a 84 anos e residentes das aldeias: Mrotidjãm; Bakajá; Pỳtakô; Pàt-krô e
    Pỳkayakà. De acordo com o conhecimento dos Xikrin, os recursos aquáticos percebidos por
    eles no domínio ngô (água) e utilizados com maior frequência constituem-se de tep (peixes) e
    possibilitaram gerar uma listagem etnotaxonômica composta por 144 espécies de peixes que
    foram agrupadas em quatro categorias (consumo, comercial, iscas e artesanato) de acordo
    com a diversidade de uso na TITB, sendo 135 espécies declaradas para consumo (94% do
    total); cabe ressaltar que existe sobreposição de usos entre as espécies, ou seja, alguns peixes
    possuem múltiplas funções, sendo utilizados de diferentes maneiras, no entanto, a função
    primordial é a fonte proteica, garantindo a subsistência familiar. Conforme a sazonalidade,
    essa diversidade de peixes ocorreu em pelo menos 26 microhabitats preferenciais. A wakĩ
    (tela) foi à modalidade utilizada em todos os períodos sazonais e oportunamente foi
    construído o calendário sazonal etnoecológico na TITB, no qual foram sumarizadas as
    conexões estreitas dos componentes bióticos e abióticos existentes na região. Esses registros
    etnoictiológicos das espécies de importância cultural Xikrin representam os primeiros passos
    para o entendimento do processo de uso dos peixes e considera-se que a continuidade destes
    saberes, dizeres e fazeres Xikrin, adquiridos ao longo de muitos anos e repassados pelos
    mẽbengêt (velhos), são imprescindíveis ao cotidiano de toda a população falante e leitora do
    idioma Mẽbêngôkre, não apenas pela sobrevivência e fortalecimento das comunidades, mas
    também pelo próprio valor intrínseco de pertencimento e ser Xikrin.

  • DIEGO MAIA ZACARDI
  • ABUNDÂNCIA E DISTRIBUIÇÃO ESPAÇO-TEMPORAL DE OVOS, LARVAS
    E JUVENIS DE PEIXES DE INTERESSE ECONÔMICO NO MÉDIO RIO
    SOLIMÕES E BAIXO RIO JAPURÁ, AMAZÔNIA CENTRAL, BRASIL


  • Data: 15/09/2014
  • Mostrar Resumo
  • Este trabalho teve como objetivo verificar a composição, a abundância e a variação espacial e temporal do ictioplâncton, bem como analisar as possíveis relações entre as densidades das espécies, e os fatores abióticos, visando avaliar a importância dos ambientes de várzea da Amazônia Central no recrutamento de espécies de peixes de alto valor econômico na região, auxiliando na implementação de medidas de conservação dos recursos pesqueiros e proteção dessas áreas. As coletas de dados foram realizadas nos quatro principais momentos do ciclo hidrológico (enchente, cheia, vazante e seca) dos anos de 2010 e 2011, em diferentes ambientes aquáticos e habitats da região do médio rio Solimões e baixo rio Japurá, no entorno da Reserva de Desenvolvimento Sustentável Mamirauá (RDSM). As amostragens foram realizadas na região limnética de lagos e canais e em vegetação aquática marginal nas áreas internas de várzea da RDSM, além de diferentes habitats (desembocaduras de canais, áreas de barrancos, bancos de areia e no canal central dos rios) nos trechos dos rios. Foram realizadas amostras nos períodos diurno e noturno por meio de arrastos subsuperficiais e de profundidade na coluna d’água com uso de redes de plâncton cônico-cilíndricas. Para os habitats de capim flutuante utilizou-se uma rede específica. Em laboratório o material biológico foi triado, identificado, quantificado e classificado. Foram capturados um total de 1.846 ovos, 90.154 larvas e 2.339 juvenis de peixes, representando 181 táxons, classificados em 10 ordens, 33 famílias, 104 gêneros e 118 espécies, algumas delas migradoras e de importância comercial. As maiores densidades de captura de ovos e larvas ocorreram na enchente, durante a noite, na subsuperfície da coluna d’água, em áreas próximas às margens de ambos os rios, evidenciando uma forte sazonalidade reprodutiva e que os trechos estudados do médio rio Solimões e do baixo rio Japurá, bem como suas áreas marginais, são utilizados como áreas de desova pelos principais Characiformes migradores. Não foram encontradas diferenças nas densidades de larvas entre as amostras diurnas e noturnas ou de superfície e profundidade. As larvas de algumas espécies de maior interesse econômico se distribuíram diferentemente entre os ambientes, indicando um padrão espacial, no qual o grupo dos Characiformes foi o mais abundante nas zonas de confluência das bocas dos 8 canais de lagos de várzea com os rios, principalmente para as larvas nos primeiros estágios de desenvolvimento ontogenético. Enquanto que o grupo dos Siluriformes foi predominante no canal central dos dois rios. Os índices pluviométricos e fluviométrico, oxigênio dissolvido, temperatura da água e condutividade elétrica foram os fatores abióticos determinantes na distribuição espaço-temporal das larvas. Sugere-se que os canais de conexão dos lagos com os rios de águas brancas funcionem como principal meio de dispersão e transporte larval de indivíduos em estágios mais avançados de desenvolvimento. Estes se dispersam em direção aos principais habitats aquáticos internos da várzea, como os lagos e os bancos de vegetação flutuante, que atuam também como importantes locais para o desenvolvimento final das larvas e para o crescimento dos juvenis das espécies de Characiformes migradores que foram alvo da análise. Desta forma estas áreas de desembocadura e as áreas marginais ao longo do curso dos grandes rios de águas brancas oferecem um importante serviço ecossistêmico, atuando como locais de desova e de criadouros naturais, respectivamente, desempenhando um papel crucial para o recrutamento biológico dos recursos pesqueiros de maior interesse econômico para a região. Estes resultados ressaltam a importância da conservação e integridade destes ambientes de várzea, uma providência fundamental para a manutenção da pesca em toda a região da Amazônia Central, justificando ações de manejo que visem a manutenção da produção pesqueira e a preservação de muitas espécies da ictiofauna.

  • LIZIANE AMARAL BARBOSA GONÇALVES
  • Caracterização estrutural e ultraestrutural das células do epitélio gonadal de Hypophthalmus marginatus (VALENCIENNES 1840).
  • Data: 05/09/2014
  • Mostrar Resumo
  • Hypophthalmus marginatus é um siluriforme, pertencente à família Pimelodidae. Na Amazônia oriental esta espécie é altamente consumida, e possui uma grande importância sócio-econômica para a região. Estudo da caracterização histológica do sistema reprodutivo ainda é desconhecido nesta espécie. Portanto, este estudo serve de ferramenta para as técnicas de biotecnologia, necessárias para a produção em cativeiro, visto que a espécie é um dos recursos pesqueiro mais intensivamente explorado pela pesca artesanal. O objetivo do presente estudo foi analisar os aspectos estrutural e ultraestrutural das células do epitélio germinativo de Hypophthalmus marginatus durante a espermatogênese. Foram capturados 168 espécimes no período entre dezembro de 2011 a dezembro de 2012, sendo identificados macroscopicamente 69 machos adultos, ainda em campo foi realizada uma incisão ventral e fragmentos da região mediana dos testículos e sêmen foram retirados e submetidos ao processamento e análise em microscopia eletrônica de transmissão e varredura. Os estudos evidenciaram que as células germinativas se proliferam no interior do cisto espermático de forma sincrônica. As espermátides entram no processo de espermiogênese passando por três fases distintas de diferenciação celular. O núcleo não se move em relação ao eixo flagelar e os centríolos não migram para o núcleo. Os espermatozóides liberados no lúmen do túbulo seminífero apresentaram uma cabeça esférica com o núcleo altamente condensado e sem acrossoma, a peça intermediária curta contendo um único flagelo longo com axonema apresentando o microtúbulo padrão (9+2), a fossa nuclear excêntrica alojava parcialmente o centríolo proximal. A presença de células espermatogênicas na mesma subfase da meiose no interior do cisto é caracterizada como espermatogênese cística, com desenvolvimento sincrônico das células, Isto sugere que espermiogênese de H. marginatus seja do tipo III e a presença da fossa nuclear é considerada uma característica distinta para a espécie, o que difere de outros pimelodideos.
  • ANA CAROLINA ANDRADE PEREIRA
  • Salmonella em Boa constrictor constrictor procedente de criatório comercial: isolamento, sorotipagem e sensibilidade a antimicrobianos

  • Data: 29/08/2014
  • Mostrar Resumo
  • Os répteis tem se tornado muito populares como animais de estimação, principalmente na Europa e nos Estados Unidos, no Brasil, porém, sua popularidade cresce a cada ano, principalmente o grupo das serpentes. A Salmonella spp. é uma enterobactéria que pode causar severos casos de gastroenterite no homem, sendo uma das principal causa de doenças veiculadas por alimentos no mundo. Em relação à transmissão animal, os répteis em geral, podem atuar como portadores assintomáticos. O presente estudo foi realizado em um criadouro comercial autorizado pelo IBAMA, que se destina à venda de Jiboias-da-Amazônia para animais de estimação. Foram avaliadas amostras de 17 serpentes para isolamento de cepas, para posterior sorotipagem, no Laboratório de Enteroinfecções do Instituto Evandro Chagas, Ananindeua, PA, onde também foram colhidos suabes cloacais, acondicionados em meio de Stuart e semeados nos meios: Ágar Macconkey, Ágar SSA (Salmonella-Shigella Agar) e caldo Rappaport (meio enriquecido para o isolamento de espécies de Salmonella), após a confirmação de Salmonelas, as cepas foram enviadas para sorotipagem no Laboratório de Referência Nacional para Enteroinfecções Bacterianas (LRNEB), do Instituto Oswaldo Cruz, (FIOCRUZ/RJ). Das 17 amostras colhidas para seleção das cepas, nove foram positivas, sendo duas identificadas em subespécie Salmonella enterica subs. diarizonae e as demais identificadas em Salmonella spp. com os sorotipo Oraniemburg (4 animais), Alachua (1 animais),  Schwarzenburg (1 animais) e Senftenberg (1 animais). Em relação à sensibilidade das cepas de Salmonella, foram testados 17 antibióticos definidos pelo setor de enteroinfecções do Instituto Evandro Chagas e as cepas foram sensíveis à maioria das drogas. Foi possível realizar o isolamento, sorotipagem e testar a sensibilidade à antimicrobianos de cepas Salmonella spp. obtidas de jiboias destinadas a animais de estimação, o que ressalta mais uma via de contaminação não só para criadores, mais também para profissionais de instituições mantenedoras de serpentes.

  • BIANCA DAMASCENO PINHO
  • Consumo, digestibilidade dos nutrientes e comportamento ingestivo, em ovinos sob dieta
    com níveis de inclusão de farelo de dendê (Elaeis guineenses)

  • Data: 29/08/2014
  • Mostrar Resumo
  • O objetivo deste estudo foi avaliar os efeitos dos níveis crescentes de farelo de dendê (Elais
    guineensis)  -  FD, nos níveis de 0, 15, 30, 45 e 60% na matéria seca total da dieta, em
    substituição à silagem de milho sobre o  consumo voluntário, digestibilidade aparente dos
    nutrientes e comportamento ingestivo em ovinos. Foram utilizadas 20 fêmeas, com média de
    35 kg, mantidas em gaiolas metabólicas individuais, que recebiam a dieta em duas refeições,
    as 8h e 17h, distribuídos em delineamento inteiramente ao acaso, em cinco tratamentos e
    quatro repetições. O experimento foi realizado na Embrapa Amazônia Oriental, Belém, Pará,
    durante 30 dias, dos quais 21 de adaptação à dieta e instalações, cinco dias de coleta de dados
    para determinação do consumo e digestibilidade aparente dos nutrientes, e quatro dias de
    avaliação do comportamento ingestivo animal. Foram observados efeito linear crescente
    (P>0,05) nos consumos de todos os nutrientes, com exceção do extrato etéreo (EE) e
    carboidrato não fibroso (CNF), que não apresentaram efeito (P>0,05), em função dos níveis
    de FD na dieta. Observou-se efeito quadrático (P<0,05) sobre a digestibilidade aparente dos
    nutrientes, com valores máximos nos níveis de 31% a 40,4% de inclusão de FD na dieta,
    exceto para o coeficiente de digestibilidade do EE (CDEE) e coeficiente de digestibilidade do
    CNF (CDCNF), que não apresentaram efeito (P>0,05). Os animais reduziram o tempo de
    alimentação e aumentaram o  tempo despedido em ócio, com valor máximo de 14 horas/dia,
    com a inclusão de 37,62% de FD. O número de bolos ruminados por dia não foram
    influenciados pelos níveis de FD na dieta, enquanto o tempo de ruminação por bolo
    apresentou comportamento quadrático,  com valor mínimo de 44,37/segundo, no nível de
    35,19% de FD. O número de mastigações merícicas (NMM) apresentou comportamento
    quadrático, com valores mínimos estimados de 51,16 MM/bolo e 32.002,44 MM/dia,
    respectivamente, com 33,68% e 35,06% de inclusão do subproduto. Os consumos de matéria
    seca (MS) e fibra em detergente neutro (FDN) foram influenciados pelos níveis de FD na
    dieta, o que provocou alterações na eficiência de alimentação e ruminação (g MS e g
    FDN/hora) e ruminação em (g MS e g FDN/bolo). A inclusão de FD aumenta o consumo de
    MS da dieta, melhora o comportamento ingestivo e, quando utilizada até o nível de 40% na
    dieta, não compromete a digestibilidade dos nutrientes.

  • JANAINA TELES DA SILVA MAIA
  • Análise bioeconômica da produção de novilhos precoces de diferentes grupos genéticos
    terminados em confinamento, em Paragominas, Pará.

  • Data: 29/08/2014
  • Mostrar Resumo
  • O objetivo  deste trabalho  foi avaliar a viabilidade de um sistema de  terminação de
    novilhos  precoces,  em  regime de  confinamento,  a partir de  indicadores zootécnicos e
    econômicos, assim como, comparar o desempenho de diferentes grupos genéticos (zebuínos e
    cruzamentos com taurinos). O estudo foi realizado em uma propriedade privada no município
    de Paragominas, Pará, onde foram utilizados no experimento animais do próprio sistema de
    produção, aleatoriamente selecionados, a partir de  três  grupos  genéticos:  Nelore, ½Angus
    ½Nelore e ½Charolês ½Nelore, porém com data de nascimento e peso aproximados, ou seja,
    do mesmo grupo contemporâneo. O experimento foi realizado nos anos de 2012 e 2013 com
    animais oriundos da  estação de nascimento de 2010  (67 animais)  e 2011  (63 animais),
    respectivamente, sendo todos com idade média de 21 meses no início do confinamento. Para
    avaliação do desempenho  zootécnico os animais foram pesados a cada 28 dias, respeitando
    um  jejum de sólidos de 16h. A  cada semana foram  coletadas  amostras do alimento
    concentrado, silagem e dieta  total  (silagem+concentrado),  para análise bromatológica. Os
    dados econômicos foram coletados  na propriedade,  e posteriormente tabulados e analisados
    em MS Excel. Os resultados relevaram destaque para os animais do cruzamento ½Charolês
    ½Nelore quanto a médias dos indicadores de desempenho, estatisticamente não diferenciando
    em alguns aspectos, do cruzamento ½Angus ½Nelore, porém sempre com valores superiores.
    Quanto aos dados econômicos o confinamento apresentou indicadores positivos para os dois
    anos de experimento,  com  lucratividade e rentabilidade média de  8,5% e 9%,
    respectivamente, com destaque  para o grupo genético ½Charolês  ½Nelore como o mais
    rentável devido ao maior rendimento de carcaça.

  • CRISTIANE DO SOCORRO BARROS DE OLIVEIRA
  • ÓLEO DE FRITURA RESIDUAL NA ALIMENTAÇÃO DE OVINOS: CONSUMO E
    DIGESTIBILIDADE

  • Data: 27/08/2014
  • Mostrar Resumo
  • Objetivou-se  avaliar o efeito  da  inclusão de óleo de fritura residual  no consumo e
    digestibilidade aparente  da matéria seca e dos nutrientes das dietas  e  balanço de nitrogênio.
    No ensaio do consumo e digestibilidade aparente utilizou-se  20 cordeiros  da  raça  Santa Inês,
    com idade média de 90 dias e peso  corporal médio inicial de 19,29±3,17 kg, em delineamento
    inteiramente casualizado.  O período experimental teve duração  de 19 dias,  14  dias de
    adaptação e  cinco de coleta  total das dietas fornecidas, sobras, fezes e urina. A  coleta total das
    fezes  foi realizada em coletores de plástico e pesada diariamente.  A urina foi  coletada em
    baldes de plástico e adicionada diariamente nos coletores solução de ácido clorídrico a 10%.
    Os animais foram alojados em gaiolas metabólicas individuais e alimentados duas vezes ao
    dia,  com  dietas a base  de  volumoso e concentrado (50:50),  enquanto  o óleo residual foi
    incluído nas dieta nas concentrações 0; 2; 4; 6 e 8% da matéria seca do concentrado.  A adição
    do óleo de fritura residual não apresentou efeito significativo  (p>0,05)  no consumo de  matéria
    seca (MS),  proteína bruta (PB),  matéria orgânica (MO),  fibra em detergente neutro (FDN),
    fibra em detergente acido (FDA),  carboidrato total (CHOT),  carboidrato não fibroso (CNF).
    No entanto, o consumo de extrato etéreo (CEE)  aumentou linearmente com a inclusão de óleo
    no concentrado, Y= 0,0244+0,0051X (p<0,01). Também,  não houve efeito na digestibilidade
    da MS, PB, MO, FDN, FDA, CHOT  e CNF  e balanço de nitrogênio. A  digestibilidade do EE
    aumentou  linearmente  com a inclusão do óleo na dieta, Y= 83,68+1,66X  (p<0,01). A  inclusão
    do  óleo de fritura residual , na dieta de ovinos,  no nível  de inclusão de até 8% na matéria seca
    no concentrado pode ser utilizada  sem prejuízo  ao consumo e digestibilidade dos nutrientes.

  • GERSON PAULINO LOPES
  • Estudo anatômico-histológico descritivo do sistema reprodutor feminino de três espécies do gênero Saimiri Voigt, 1831 (Primates, Cebidae)
  • Data: 18/08/2014
  • Mostrar Resumo
  • Recentemente, táxons do grupo Saimiri sciureus considerados como subespécies foram elevados ao nível de espécie, entre eles estão Saimiri macrodon (Elliot, 1907) e Saimiri cassiquiarensis (Lesson, 1840) (CARRETERO-PINZÓN, RUIZ-GARCÍA, &DEFLER, 2009; PAGLIA et al., 2012). Essa classificação taxonômica atual abre a possibilidade para novos estudos, uma vez que algumas pesquisas podem não ter sido realizadas com indivíduos da espécie Saimiri sciureus. Dessa forma, o presente trabalho teve como objetivo contribuir com a descrição anátomo-topográfica e histológica do sistema reprodutor feminino de Saimiri macrodon, Saimiri cassiquiarensis e Saimiri vanzolinii.
  • KAMILA LEÃO LEÃO
  • MANEJO DE SCAPTOTRIGONA SP. (HYMENOPTERA, APIDAE, MELIPONINI)
    PARA POLINIZAÇÃO DA RAMBUTEIRA (NEPHELIUM LAPPACEUM L.)

  • Data: 31/07/2014
  • Mostrar Resumo
  • Os meliponíneos são excelentes opções de insetos para serem manejados e utilizados na
    polinização de culturas agrícolas. O presente trabalho teve como objetivo geral manejar
    abelhas sem ferrão do gênero  Scaptotrigona  para incremento da polinização da rambuteira
    (Nephelium lappaceum  L.). Foi utilizada  Scaptotrigona  sp. como modelo experimental. O
    primeiro capítulo focou a questão da fenologia da planta. Foi estudado o período de
    ocorrência e a duração dos estádios fenológicos da floração e frutificação do rambotã, em
    ambiente agrícola. Foi concluído que a floração da rambuteira no Estado do Pará ocorre em
    dois períodos no ano e a duração média de todo o ciclo reprodutivo da rambuteira nos dois
    anos de estudo foi de 123 e 128 dias, respectivamente. O segundo capítulo teve como objetivo
    avaliar se a introdução de colmeias de abelhas  Scaptotrigona  sp. promove o aumento da  
    frutificação da rambuteira. Foi concluído que não ocorreu diferença significativa na
    frutificação efetiva do rambotã com a presença de abelhas, contudo, a abelha Scaptotrigona
    sp. apresentou altos índices de fidelidade polínica as  flores do rambotã. Por fim, o terceiro
    capítulo foi focado em um ponto específico da criação de abelhas. Foi testado um modelo de
    caixa para criação de  Scaptotrigona  sp., avaliando aspectos como adaptação biológica e
    manejo das colônias. Estudou-se também seu desempenho em relação à um modelo de caixa
    cabocla. Foi demonstrado que a caixa testada (Embrapa) apresentou resultados satisfatórios,
    podendo por tanto ser utilizada na criação racional desta espécie.

  • LUIZA LOUREIRO DE ARAÚJO
  • A eutanásia de camundongos A com tiopental sódico após medicação pré-anestésica: avaliação dos efeitos das drogas e de alterações histológicas nos rins, baço e fígado
  • Data: 18/07/2014
  • Mostrar Resumo
  • O tratamento ético é fundamental em todas as atividades em que haja o envolvimento animal, estando em plena ascensão na área da experimentação, o que está diretamente relacionado com o crescimento de estudos na área da ética e do bem-estar animal, além do forte apelo da sociedade, que vem exigindo mais esclarecimentos a respeito desse assunto. É necessário que os profissionais envolvidos no trato com os animais desenvolvam a consciência de que seu reagente biológico está vivo e com isso, passível de sofrer. Sendo assim os estudos tem tido cada vez mais refinamento nas diferentes etapas, incluindo a fase terminal ou de eutanásia, a qual passa ser obrigatória que seja feita de forma humana. Dessa forma, o presente estudo objetiva avaliar um importante método de eutanásia, realizado com a administração intraperitoneal de sobredose de tiopental sódico, antecedido de medicação pré-anestésica composta pela associação do cloridrato de dextrocetamina e de xilazina, realizado em trinta fêmeas adultas de camundongo A, aproveitadas do projeto CEUA/FIOCRUZ Nª L034/09. Os resultados obtidos demonstram que o protocolo utilizado apresentou viabilidade e exequibilidade, especialmente sob a ótica animal, já que quando realizado de acordo com a proposta do estudo, proporcionou aos animais uma morte rápida e tranquila, além de ter conferido pouca interferência nos tecidos estudados, que de forma geral, não demonstraram, na avaliação histológica, comprometimento na estrutura tecidual, sugerindo que o protocolo, na dosagem utilizada, apresentou-se como adequado para a prática de eutanásia na espécie.
  • ROGERIO LOPES CARVALHO
  • O caranguejo-uçá, Ucides cordatus (Linnaeus 1763): Da Captura à Comercialização no Âmbito das Comunidades Quilombolas Cacau e Terra Amarela, Ilha de Colares, Pará, Brasil

  • Data: 10/07/2014
  • Mostrar Resumo
  • Este estudo foi realizado nas comunidades quilombolas Cacau e Terra Amarela, Município de Colares, Estado do Pará. Como objetivo geral, buscou-se obter, de forma participativa, um diagnóstico da explotação e comercialização do caranguejo-uçá (Ucides cordatus), levando em conta a socioeconomia, técnicas, estratégias e áreas de produção, bem como as formas de comercialização do crustáceo nessas localidades quilombolas, em comparação com outras populações tradicionais relacionadas com a atividade. Foram aplicados questionários, e realizados observação direta e fluxogramas participativos, desenvolvidos ao longo do ano de 2013. Este diagnóstico definiu as atividades de extrativismo como sendo as principais ocupações dos moradores, e a tiração de caranguejos como a mais importante delas. Em Cacau e Terra Amarela as famílias possuem médias de 4,3 e 4,9 indivíduos por moradia, respectivamente, habitando, em sua maioria, moradia própria, construída em alvenaria na maior parte dos casos. Porém, vivem em más condições de vida e sem quase nenhum acesso aos serviços públicos. Em geral, os tiradores abandonaram o estudo cedo nas duas comunidades, apresentando a maioria ( 72 e 82%) apenas o ensino fundamental incompleto. Além disso, foi registrada uma renda familiar mensal baixa, em sua maioria variando de menos de meio a um salário mínimo. A atividade é exercida quase que pelo ano todo, havendo preferencia por capturas durante os meses do período seco na região, na chamada “safra do caranguejo branco”, aonde são utilizadas as técnicas do laço e braceamento como principais meios de produção. Há, entretanto, um uso majoritário do laço durante esse período de safra. Em média dedicam-se à captura por braceamento por aproximadamente quatro dias por semana (no período de cheia), e alocam 12 dias por mês na captura por laço (período de seca). São produzidos em média na comunidade do Cacau, no período da cheia e da seca, respectivamente, 52 ± 15 e 110 ± 56 caranguejos por dia de trabalho; e na comunidade de Terra Amarela, médias de, respectivamente, 56 ± 24 e 150 ± 72 caranguejos por dia de trabalho no mangal. Comercializam sua produção diretamente com marreteiros (ou intermediários) da região, na forma in natura, inteiro e com animais ainda vivos. Geralmente são acondicionados para o transporte em cofos na comunidade do Cacau e em sacos de polipropileno no caso de Terra Amarela. O escoamento para o mercado mais próximo é feito por meio do barco da comunidade ou rabetas na comunidade do Cacau. Na comunidade de Terra Amarela o escoamento é realizado apenas através de rabetas. Os caranguejos são negociados por preços que oscilam ao longo do ano todo, de R$ 40,00 a R$ 80,00 o cento (100 unidades). A baixa remuneração, associada ao baixo nível de escolaridade, a deficiência da infraestrutura e tecnologia de produção, e à ausência do poder público local para prover serviços são alguns dos principais responsáveis pela baixa qualidade de vida dessas famílias das comunidades estudadas, e também pela manutenção de uma atividade de tão baixo valor agregado. Tais condições mostraram-se bastante semelhantes às de outras comunidades tradicionais não-quilombolas que vivem e trabalham em condições semelhantes na região costeira do Pará. No tocante aos aspectos da extração e comercialização de caranguejo-uçá de Cacau e Terra Amarela, eles são em muito semelhantes à maioria das comunidades tradicionais que exploram este recurso junto aos manguezais da costa paraense e de outras regiões. Por outro lado, foram identificadas diferenças significativas entre as duas comunidades estudadas, que representam pequenas variações deste padrão geral descrito. Estas diferenças estão provavelmente relacionadas às variações tecnológicas existentes, e à abundância local do recurso. Estas diferenças, por sua vez, se observam também nos custos da atividade e, portanto, na sua lucratividade, e na qualidade de vida dos tiradores de Cacau e de Terra Amarela. É importante e necessário que se conheçam bem estas diferenças, e suas reais causas, e as maneiras pelas quais elas influenciam o modo como os tiradores se organizam no seu trabalho extrativista. Somente assim será possível o planejamento de medidas de intervenção visando o aperfeiçoamento da atividade, e o incremento da qualidade de vida destas populações pelos agentes públicos.

  • MARCOS DUTRA DUARTE
  • Intoxicação por sal em ovinos e caprinos no estado do Pará
  • Data: 30/06/2014
  • Mostrar Resumo
  • O presente trabalho relata os primeiros surtos de intoxicação por sal em pequenos ruminantes no Brasil, em uma propriedade no estado do Pará. A avaliação das instalações e do manejo indicaram, como fatores predisponentes, a ingestão excessiva de mistura mineral e a restrição hídrica. O primeiro surto ocorreu em ovinos, quando de 545 animais, oito (1,46%) adoeceram e destes, quatro (50%) morreram. O segundo e o terceiro surtos afetaram um rebanho de 191caprinos. No segundo surto, quatro (2,09%) animais adoeceram e nenhum morreu. No terceiro surto, oito caprinos (4,19%) adoeceram e dois (25%) deles morreram. Os principais sinais clínicos observados nos ovinos foram decúbito, diminuição ou ausência da sensibilidade cutânea, ausência dos reflexos de ameaça, palpebral e auricular, midríase, nistagmo, opistótono, espasticidade de membros, sonolência e estupor. Observaram-se ainda, timpanismo, diarreia, taquipneia, taquicardia, desidratação e poliúria. A evolução do quadro clínico nos ovinos que morreram variou de duas horas e meia a 48 horas. Nos caprinos, os principais sinais clínicos observados foram fraqueza muscular, alterações de postura da cabeça e do pescoço como permanência com a cabeça baixa, rotação da cabeça e do pescoço, extensão e desvio lateral do pescoço, decúbito esternal e lateral, midríase, ausência do reflexo pupilar à luz, permanência com os membros pélvicos e torácicos abduzidos ou em ampla base, aumento do reflexo flexor, micção frequente e sede intensa. Observaram-se ainda, hipomotilidade ruminal, taquicardia, diminuição do turgor cutâneo. A evolução do quadro clínico nos caprinos do segundo surto variou de quatro a 24 horas. Nos caprinos do terceiro surto a evolução foi de seis e oito horas nos que morreram e de dois a três dias nos caprinos que se recuperaram. As médias das concentrações séricas de sódio e de potássio de 31 ovinos do mesmo lote afetado pela intoxicação, em amostras colhidas durante o surto, revelaram hipernatremia (190mEq/l) e hipercalemia (8,2mEq/l), respectivamente. Nos caprinos, as médias das concentrações séricas de sódio e de potássio de 36 caprinos do mesmo lote dos animais afetados no segundo surto, em amostras colhidas dois dias antes do início dos sinais clínicos, revelaram hipernatremia (167mEq/l) e nível médio de potássio (4,7mEq/l) dentro dos valores de referência para a espécie. No entanto, as médias desses mesmos parâmetros, em amostras de caprinos do terceiro surto, com sinais clínicos da intoxicação (143,7mEq/l para o sódio e 3,9mEq/l para o potássio), estavam dentro dos valores de referência. Em apenas um dos quatro ovinos que morreram, foi observado à necropsia achatamento das circunvoluções cerebrais. Microscopicamente, neste ovino havia vacuolização moderada do neurópilo, particularmente nas lâminas intermediárias do córtex cerebral, com aumento dos espaços perineural e perivascular. Nessas áreas foram observados ainda, acentuada tumefação e edema dos astrócitos e necrose neuronal aguda. Nos caprinos não foram observadas lesões macro e microscópicas. As dosagens de sódio realizadas em amostras de encéfalo dos animais intoxicados revelou, em um ovino, valor de 3.513 ppm e em dois caprinos, valores de 3.703 e 3.675 ppm. Cinco caprinos do terceiro surto foram tratados com dexametasona e tiamina, por via intramuscular, duas vezes ao dia, durante dois dias, além da ingestão de água, em pequenas quantidades, três vezes ao dia. Todos os animais tratados estavam recuperados em três dias. O diagnóstico foi realizado com base na epidemiologia, nos sinais clínicos, nas lesões observadas, nas dosagens de sódio no soro e no encéfalo e na resposta ao tratamento.
  • CARLOS MAGNO CHAVES OLIVEIRA
  • Diagnóstico das deficiências de macro e micro minerais em búfalas  (Bubalus bubalis)
    provenientes da Ilha de Marajó, Estado do Pará. 

  • Data: 30/06/2014
  • Mostrar Resumo
  • Objetivou-se avaliar as concentrações de fósforo no soro e no osso, o percentual de
    cinzas e a densidade específica e os níveis de cobre, cobalto, selênio, zinco e ferro no fígado
    de búfalas da Ilha de Marajó antes e após suplementação mineral seletiva. Foram utilizadas 14
    búfalas mestiças de Murrah com Mediterrânea  com idade entre 18 e 36 meses. Os  valores
    médio de fósforo, antes da suplementação,  foram de 5,68mg/dl±1,18  no soro e de
    16,53%±0,53  no osso. O  percentual de cinzas  foi de  59,95%±1,96  e a densidade óssea
    específica foi de 1,52g/cm3
    ±0,32 , o que demonstra deficiência de fósforo nos animais criados
    na Ilha de Marajó.  Os  valores médios de cobre  foram de  7,75ppm±1,73,  os de  cobalto  
    0,40ppm±0,17,  os de  zinco  88,01ppm±35,03,  os de  selênio  0,22ppm±0,12 e  os  ferro
    1.395,72ppm±764,74. Esses resultados  demonstram  deficiência de cobre,  de  zinco e  de
    selênio, valores adequados de cobalto e excesso de ferro no fígado. Após a suplementação por
    um período de sete meses os valores  de fósforo  foram de 6,61mg/dl±0,87  no soro e de
    16,90%±0,56  no osso.  O  percentual de cinzas  foi de  60,30%±0,95  e a densidade óssea
    específica  de  1,71g/cm3
    ±0,21. Esses valores caracterizam  um aumento significativo nas
    concentrações de P no soro sanguíneo,  no percentual de  P  nas cinzas  e na  densidade  óssea
    específica (P<0,05), porém não houve um aumento significativo no percentual  de cinzas no
    osso. O aumento médio nos valores de  P  no osso e nas cinzas não alcançou patamares de
    normalidade, entretanto 28,6% dos animais tinham valores normais de P no soro, 50% tinham
    valores normais de P nas cinzas e 64,3% dos animais tinham densidade  óssea  específica
    normal . Não houve resposta à suplementação em relação ao percentual de cinzas.  Em relação
    aos micro minerais após a suplementação os valores foram de    205,41ppm±80,54  para o
    cobre,  0,40ppm±0,22  para o cobalto,  75,71ppm±11,74  para o zinco, 1,30ppm±1,34  para o
    selênio e 826,48ppm±394,76 para o ferro, o que evidencia um aumento significativo (P<0,05)
    nas concentrações de cobre e selênio e uma diminuição significativa nos valores de ferro
    (P<0,05). Não houve uma recuperação  nos valores de zinco e as concentrações de cobalto
    permaneceram dentro dos valores de normalidade. O não aumento das concentrações de zinco
    no fígado após a suplementação pode ter ocorrido em virtude das concentrações elevadas de
    cálcio na Brachiaria brizantha cv Marandu utilizada na alimentação dos animais.

  • RENATA NUNES SILVA
  • Localização do receptor de melatonina Mel1a e da enzima NRH: quinona
    redutase 2 em embrião e retinas inteiros de Kinosternon scorpioides

  • Data: 27/06/2014
  • Mostrar Resumo
  • A melatonina hormônio produzido pela glândula pineal, e também por outros
    tecidos como a retina é responsável por sinalizar aos seres vivos se está claro ou
    escuro. Melatonina  tem  ação no desenvolvimento via o receptor de membrana
    Mel1a e a enzima NRH: quinona redutase 2 (QR2). Dessa forma, o  objetivo do
    presente estudo foi  iniciar a  localização do  receptor de membrana Mel1a e da
    enzima NRH: quinona redutase 2 (QR2)  no desenvolvimento de vertebrados,
    tomando como  modelo animal  o desenvolvimento da tartaruga de água doce
    Kinosternon scorpioides (muçuã). Para tanto, retinas e embriões inteiros de 21 dias
    (E21)  e de animais pós-eclodidos  (PH)  com 60 dias de vida foram submetidos  à
    imunohistoquímica e imunoensaios, usando anticorpos comerciais e  visualizados
    com o anticorpo fluorescente Texas  red. Tanto o receptor Mel1a, quanto a enzima
    QR2 foram localizados em importantes caracteres morfológicos externos em E21 e
    nas retinas de embriões E21 e PH. Os resultados mostraram que o receptor Mel1a
    está presente em E21 nas regiões maxilar e mandibular, no  contorno externo do
    olho, na íris, fissura coróide, pescoço, membros anteriores e posteriores alongados,
    carapaça rudimentar, além da parte interna da cauda em brotamento. As marcações
    que  a enzima QR2  produziu nos embriões de  21 dias (E21)  ocorreram  nos
    caracteres morfológicos externos  a seguir.    Na cabeça, região maxilar; no  olho,
    cristalino e íris;  membros anteriores e posteriores alongados e  na  cauda em
    brotamento.  Nenhuma fluorescência foi observada nos  controles negativos
    incubados sem o  anticorpo primário. Sendo assim, nossos achados sugerem que
    melatonina  tem participação  no desenvolvimento de  Kinosternon scorpioides,  seja
    na ossificação, papel do receptor Mel1a, seja na proteção contra xenobióticos, papel
    da QR2. O papel da melatonina no desenvolvimento de tartarugas ainda está longe
    de ser completamente desvendado, mas encontramos algumas respostas
    interessantes e surgiram perspectivas para investigações futuras. 

  • DANILLO HENRIQUE DA SILVA LIMA
  • Prevalência sorológica e molecular de Babesia bovis e Babesia bigemina em búfalos
    (Bubalus bubalis) na Ilha de Marajó, Pará

  • Data: 26/06/2014
  • Mostrar Resumo
  • O objetivo do presente estudo foi verificar a prevalência  sorológica e molecular de Babesia
    bovis e Babesia bigemina em búfalos da Ilha de Marajó, estado do Pará, Brasil. Foi utilizado o
    Ensaio de Imunoadsorção Enzimático indireto (ELISAi) com antígeno total contendo
    proteínas de superfície externa e  a Reação em Cadeia  da Polimerase  quantitativa  (PCRq),
    envolvendo o uso de SYBR Green com base na amplificação de um pequeno fragmento de
    gene do citocromo b.  A prevalência de animais positivos no ELISAi  para  B. bovis,  B.
    bigemina  e  para  infecção mista foi de 24.87% (199/800), 20.75% (166/800) e 18.75%
    (150/800), respectivamente. Na PCRq foi detectado a presença de B. bovis em 15% (18/199) e
    de B. bigemina em 16% (19/199) dos animais, sendo que destes, 58% (11/19) apresentavam-
    se co-infectados pelos dois agentes.  Os resultados mostram uma baixa prevalência de
    anticorpos anti-B. bovis e anti-B. bigemina em búfalos da Ilha do Marajó. Porém, observou-se
    que os agentes da babesiose bovina circulam em búfalos, podendo atuar como reservatório.  

  • KAROL GUIMARAES OLIVEIRA
  • Biometria testicular, caracterização e congelamento de sêmen de macacos-de-cheiro de vida livre (Saimiri vanzolinii, S. cassiquiarensis e S. macrodon) e cativeiro (S. collinsi) em água de coco em pó (ACP-118®)
  • Data: 24/06/2014
  • Mostrar Resumo
  • Recentemente, o táxon Saimiri sciureus (macaco-de-cheiro) foi revisado e algumas subespécies são agora classificadas como espécies por alguns autores como: Saimiri collinsi, S. cassiquiarensis e S. macrodon. Características fenotípicas nestas espécies são bem determinadas. No entanto, informações sobre aspectos reprodutivos são ainda bastante escassas. O objetivo da primeira fase do trabalho foi determinar e correlacionar biometria testicular e análise do sêmen de macacos-de-cheiro de cativeiro (S. collinsi) e de vida-livre (S. vanzolinii, S. cassiquiarensis e S. macrodon). Foram mensurados comprimento, largura, altura e volume testiculares, bem como peso corporal do animal para a correlação de dados. O sêmen foi coletado por eletroejaculação. Não foi observada diferença entre testículos direito e esquerdo dentro de cada espécie. Observou-se correlação positiva entre o volume testicular e peso corporal apenas em S. vanzolinii e S. cassiquiarensis. O ejaculado foi constituído principalmente por uma fração coagulada em todas as espécies. Não foi observada correlação entre volume testicular e volume seminal. A qualidade do ejaculado foi semelhante entre as espécies. A segunda fase do trabalho teve como objetivo propor um protocolo de congelamento de sêmen de S. collinsi em diluidor a base de ACP-118® (água de coco em pó) testando duas concentrações de glicerol (1,5 e 3%) e um protocolo de resfriamento de sêmen sem adição de gema de ovo. Os protocolos desenvolvidos nos animais de cativeiro foram testados em campo nos animais de vida-livre com resultados bastante satisfatórios.
  • ROBERTO DE FARIA ESPINHEIRO
  • Identificação da microbiota do trato gastrointestinal de caititus

  • Orientador : HILMA LUCIA TAVARES DIAS
  • Data: 16/06/2014
  • Mostrar Resumo
  • Este trabalho teve como objetivo identificar micro-organismos presentes no trato gastrointestinal e fezes de 30 caititus (Pecari tajacu) criados em cativeiro, assim como testar a eficácia de antimicrobianos frente bactérias isoladas. Para isso, foram realizadas avaliações microbiológicas da bolsa gástrica, estômago glandular, saco cego ventral, saco cego dorsal, intestino delgado e fezes. As amostras foram semeadas em Agar MacConkey, Agar Sangue de carneiro desfibrinado a 5% e Agar XLD para pesquisa de Salmonella sp. e incubadas em estufa bacteriológica à 37ºC por 24 a 48 horas. Foi obtido um total de 243 bactérias, no qual 182 eram bactérias Gram-negativas e 61 bactérias Gram-positivas.As espécies que mais se destacaram em todo o trato gastrointestinal dos animais estudados foram E. coli(44,03%), Micrococcus (9,87%), Citrobacter(6,17%),Klebsiella (5,76%), Sthaphylococcus (4,94%),Pseudomonas (4,11%) e Streptococcus (4,11%). Os antimicrobianos mais eficientes contra as cepas de E. coliforam ácido nalidíxico, aztreonam, gentamicina e nitrofurantoina, os que apresentaram maior índice de resistência foram a clindamicina, lincomicina, penicilina G e vancomicina. As cepas de Streptococcus sp. apresentaram resistência a todos os antimicrobianos testados. Os isolados de Staphylococcus sp. foram 100% sensíveis a amicacina, doxicilina e gentamicina. Concluímos que bactérias gram-positivas e gram-negativas estão presentes no trato gastrointestinal de caititus, com destaque para E. coli, sendo também eliminada nas fezes. Esses animais são portadores de bactérias que representam risco a saúde publica como E. coli, Shigella sp. e Aeromonas sp. O nível de resistência a antimicrobianos nas cepas de E. coli, Staphylococcus sp. e Streptococcus sp mostrou-se elevado para vários agentes, caracterizando essas bactérias como multirresistentes. Esse conhecimento permite um manejo mais adequado dos animais e a utilização mais racional dos antibióticos, visando minimizar as perdas econômicas e o tratamento mais eficaz dos animais enfermos.

  • ANA CASSIA SARMENTO FERREIRA
  • Produção in vitro de embriões de caititu (Pecari tajacu) criados em cativeiro

  • Data: 13/06/2014
  • Mostrar Resumo
  • Trata-se da aplicação de biotecnicas de reprodução na espécie Pecari tajacu para melhorar seu
    potencial para  a criação em  cativeiro visando sua produção, conservação e multiplicação de
    recursos genéticos. Para determinar o tempo de maturação in vitro foram utilizados 48 fêmeas,
    foram selecionados 69 CCOs e divididos em 4 grupos por idade e tempo de MIV, e então
    submetidos a ativação partenogenética em Ionomicina e 6-DMAP. Para análise da progressão
    meiótica 165 oócitos foram divididos em 4 grupos conforme a suplementação de hormônios na
    MIV e tempo de maturação. Na criopreservação foram utilizados espermatozoides
    epididimários de 9 machos, diluídos em Tris-frutose e ACP-120 e divididos em grupos de
    refrigeração a 4ºC e congelamento a -196ºC e  presença da glutationa (GSH), foram avaliados
    os parâmetros motilidade, vigor e viabilidade após a diluição a fresco e criopreservação. Para
    a produção de embriões, 97 oócitos após MIV de 36 horas foram divididos grupos de ativação
    partenogenética, FIV e ICSI. Através da ativação partenogenética obteve-se taxas de clivagens
    (47%) para os oócitos de fêmeas com menos de 2 anos  submetidos a MIV em 36 horas, em
    todos os grupos observaram-se clivagens porém não houve diferenças significativas (P>0,05)
    entre os grupos analisados, observou-se taxa de blastocisto (15,4%) somente no grupo de
    oócitos ativados após MIV de 44 horas.  Na analise da progressão meiótica, em todos os tempos
    analisados foram encontrados oócitos em MII. Na criopreservação dos espermatozoides
    observaram-se queda nos parâmetros analisados nos dois diluidores em todos os grupos, a
    presença da glutationa não interferiu significativamente nos parâmetros analisados.  No
    resfriamento, as taxas de motilidade e viabilidade foram superiores no ACP-120 (> 50%) e no
    congelamento em tris-frutose (33% e 18%). A produção de embriões in vitro foi bem sucedida
    na ativação partenogenética (62,9%) e na ICSI (52,6%), na FIV as taxas foram baixas (7%), a
    produção de blastocisto ocorreu somente nos embriões partenotos (4,5%). Os resultados
    mostraram a viabilidade de biotecnicas reprodutivas como conservação de gametas, e produção
    in vitro de embriões na espécie Pecari tajacu.

  • FELIPE TAMEIRAO FONSECA
  • Métodos e tempo de armazenamento sobre as características das plantas de cana de açúcar para alimentação animal
  • Data: 20/05/2014
  • Mostrar Resumo
  • Objetivou-se com o presente trabalho estudar métodos e tempo de armazenamento da cana de açúcar pós-colheita para ser utilizada na alimentação animal. A pesquisa foi composta por dois experimentos, os quais avaliaram plantas de cana de açúcar com ou sem palhas e ponteiros (CPP e SPP, respectivamente). Avaliadas em seis tempos de armazenamento pós- colheita (0; 2; 4; 6; 8; e 10 dias). Por meio de um delineamento inteiramente casualizado com três repetições em esquema de parcelas subdivididas. Características químicas, físicas e microbiológicas foram avaliadas. Em ambos os experimentos o tratamento SPP apresentou menor concentração de matéria seca, de fibra (FDN) e menores perdas de matéria seca (PMS) (P < 0,05). O tempo alterou o balanço de carbono (relação entre fotossíntese e respiração), com aumento da respiração no segundo dia de estocagem. O tempo também influenciou as PMS, tendo-se um aumento significativo no tratamento CPP. Os resultados mostram que as plantas de cana de açúcar podem ser armazenadas em galpões após o corte. O melhor método é por meio da retirada das palhas e ponteiros e por um período de até 6 dias. Caso haja necessidade de se manter o ponteiro e as palhas, estas plantas podem ser estocadas somente por 2 dias.
  • SULEIMA DO SOCORRO BASTOS DA SILVA
  • Regulação comportamental em caititus (Pecari tajacu): o efeito da estrutura social na
    função reprodutiva de fêmeas em cativeiro

  • Data: 02/05/2014
  • Mostrar Resumo
  • As falhas na fertilidade de fêmeas de caititus (Pecari tajacu) adultas criadas em cativeiro são
    um fator restritivo para a eficiência da produção e precisam ser melhor investigadas. Avaliar a
    função reprodutiva de fêmeas mantidas em sistema intensivo de criação  foi o objetivo dessa
    pesquisa. Vinte  fêmeas foram monitoradas em grupos familiares  (controles),  por 60 dias,  e
    experimentais  (fêmeas descendentes agrupadas com machos não aparentados e na ausência
    dos genitores), por mais 60 dias. As interações agonísticas, de submissão, amigáveis e sexuais
    foram filmadas três vezes na semana, a dominância social foi avaliada pelo método Elo-rating
    e a preferência social através da frequência de interações amigáveis. O  sangue foi colhido
    para dosagem de progesterona plasmática por radioimunoensaio em fase sólida e a prenhez foi
    confirmada por exame ultrassonográfico.  Em três dos quatro grupos controle  os genitores
    mantiveram-se nos postos mais elevados da hierarquia enquanto na fase experimental, as
    fêmeas descendentes ocuparam os postos mais elevados. A frequência das interações
    amigáveis recebidas dependeu do sexo e da condição (H=142.991 p<0.01), sendo  que as
    fêmeas genitoras receberam,  em média,  2,21 vezes mais interações  do  que os outros
    indivíduos. Machos e fêmeas receberam frequências iguais nos grupos experimentais. O estro
    teve duração de 3,6 ± 1,0 dias com progesterona em 1,2 ± 0,6 ng/mL e maior frequência de
    cópulas no terço final desse período. As interações sexuais aumentaram no estro em fêmeas
    (P=0.0019) e machos (P <0.0009) que intensificaram  sua frequência de inspeção olfativa.
    Cópulas foram registradas no início da prenhez. Todas as fêmeas pluríparas  (mais pesadas,
    mais velhas e dominantes)  apresentaram atividade reprodutiva (ciclicidade ou prenhez)
    enquanto sete nulíparas apresentaram períodos de anestro, curtos (16 dias) ou longos (60 dias)
    no grupo controle. No grupo experimental todas as nulíparas e a primípara  copularam e 14
    filhotes nasceram, porém, apenas cinco mantiveram-se após sete dias de vida. Demonstramos
    a presença  da dominância dos  genitores sobre  os  descendentes e  de um mecanismo de
    inibição reprodutiva  nos agrupamentos familiares. Sugerimos que  as fêmeas nulíparas em
    idade reprodutiva  sejam  remanejadas do seu grupo de origem para grupos com machos não
    aparentados,  garantindo o potencial reprodutivo da criação  e o acesso à comida, espaço e
    outros recursos preferenciais geralmente priorizados por indivíduos dominantes.

  • DANIEL VALE BARROS
  • Respostas termográficas em touros bubalinos submetidos à coleta de sêmen e
    avaliados sob condições agrometeorológicas no trópico úmido
     

  • Data: 30/04/2014
  • Mostrar Resumo
  • A produção de búfalos (Bubalus bubalis) está praticamente concentrada entre os
    trópicos, onde predominam elevadas temperaturas. Portanto, o conhecimento da
    resposta desses animais frente ao ambiente tropical e às mudanças climáticas são
    essenciais. Assim, o objetivo do trabalho foi avaliar a variação dos índices de
    conforte térmico, parâmetros fisiológicos, hemáticos, seminais e de temperaturas
    superficiais de touros bubalinos mantidos sob clima tropical úmido (Afi de Köppen).
    Dez búfalos foram mantidos em baias coletivas, com acesso à sombra. Durante os
    meses de abril a agosto de 2013 foram obtidos dados climatológicos de estação
    meteorológica e dataloggers, instalados no interior das baias para cálculo do  índice
    de temperatura e umidade (ITU). Foram aferidas frequência respiratória (FR),
    frequência cardíaca (FC), temperatura retal (TR), temperatura superficial de globo
    ocular (GLO), temperatura superficial do escroto (ESC), temperatura superficial do
    flanco direito (FLd) e esquerdo (FLe) e calculado o índice do conforto térmico de
    Benezra (ICB). Foi realizada coleta de sêmen semanalmente por vagina artificial, e
    realizada coleta de sangue para avaliação do hemograma mensalmente. A média da
    temperatura máxima do ar foi de 31,5ºC e a média da umidade relativa máxima foi
    de 93,2%. O ITU apresentou diferença somente entre  turnos (P<0,05). A FR, FC e
    ICB apresentaram incrementos significativos ao longo dos meses e com diferença
    entre turnos (P<0,05). Já a TR apresentou diferença entre turnos e variação
    decrescente nos meses, com menor valor em agosto (37,8±0,7ºC). Para os valores
    de TR, GLO, FLd, FLe e ESC houve diferença (P<0,05) tanto para o turno quanto
    para os meses. O hematócrito, volume corpuscular médio, hemoglobina corpuscular
    média, concentração de hemoglobina corpuscular média, turbilhonamento e vigor
    espermático apresentaram diferença significativa (P<0,05) ao longo dos meses. As
    maiores correlações obtidas entre ITU e temperaturas superficiais foram entre
    ITUmed e FLdmed (0,77; P<0,0001), ITUmed e FLemed (0,75; P<0,0001), ITUmed e
    GLO (0,72; P<0,0001), e ITUmed e ESC (0,41; P<0,0001). A maior correlação entre
    temperatura interna e temperatura superficial foi de TR e GLOmax (0,58; P<0,0001).
    Correlações significativas foram encontradas entre ICB e FR (0,97; P<0,0001), ICB e
    FC (0,89; P<0,0001), FC e FR (0,87; P<0,0001), ITU  e integridade de membrana
    plasmática dos espermatozoides (-0,17; P<0,05). Os  resultados mostraram que,
    apesar dos animais apresentarem variações no índice de conforto de Benezra e
    elevação da temperatura superficial nos períodos mais quentes, os touros foram capazes de manter a homeotermia. Por fim, concluiu-se, também, que a termografia
    infravermelha pode ser usada como uma ferramenta não invasiva e auxiliar nos
    estudos sobre a fisiologia da termorregulação animal.

  • MAURO MARCIO TAVARES DA SILVA
  • O Caranguejo-Uçá Ucides cordatus (Crustacea, Brachyura, Ucididae), no Litoral
    Paraense: Uma Abordagem Sobre a Atividade Extrativa no Pará.

  • Data: 31/03/2014
  • Mostrar Resumo
  • Inicialmente  o presente estudo  traz informações a respeito do potencial extrativo em
    manguezais produtivos dos municípios de Quatipuru e Bragança, bem como, a caracterização
    socioeconômica dos profissionais extrativistas (caranguejeiros)  desse recurso. Paralelo às
    informações geradas nos manguezais e nas comunidades entrevistadas em Quatipuru e
    Bragança, este estudo também procura contextualizar a atividade extrativa do caranguejo-uçá
    em todo o litoral paraense, por meio das informações obtidas pela coleta e análise dos dados
    referentes ao caranguejo-uçá em diferentes manguezais do Pará, além de caracterizar a
    atividade produtiva em importantes comunidades extrativistas deste recurso. As coletas de
    informações ocorreram no período de 2010 a 2012, onde o potencial extrativo analisado, nos
    manguezais explorados de Bragança e Quatipuru confirmam essas localidades como regiões
    potencialmente produtoras, com uma densidade de 5,01±1,09 ind/m2
      no manguezal de
    Quatipuru e 6,5±1,0 ind/m2
     no manguezal explorado em Bragança e um potencial extrativo
    imediato (PEI) de 80,91 % no manguezal de Quatipuru e 86,23 % no manguezal estudado em
    Bragança. Numa analise pontual  em comunidades dos municípios de Quatipuru e Bragança, o
    perfil dos caranguejeiros caracterizou-se por apresentar uma predominância masculina, baixa
    escolaridade, com mínimo de 16 anos de atividade em Quatipuru e mais de 20 anos para a
    maioria dos entrevistados nas comunidades de  Bragança. A  principal técnica de captura
    utilizada é o “braceamento” com auxilio do gancho em ambas localidades, onde capturam em
    média de 51 a 100 unidades/dia em Quatipuru e 101 a 150 em Bragança, onde o atravessador
    é o principal destino do produto para os locais investigados. Os dados obtidos no litoral
    paraense revelam que dos manguezais estudados, o do município de Viseu, obteve destaque
    como uma importante região extrativista, com valores representativos de densidade 4,23 ±
    1,40 ind/m2
    , de CPUE 46,6 (carang./homem/hora) e com 226,8±113,1 unidades capturadas
    por caranguejeiro/dia, entretanto, vale resaltar que nesse município foi registrado o menor
    preço médio praticado para a unidade do caranguejo (R$0,18±0,05) entre todas as
    comunidades dos municípios visitados. A importância deste recurso para as comunidades do
    litoral paraense é evidente e necessita de ações que visem ordenar a exploração, com vista à
    sustentabilidade extrativa, bem como, incentivar esses profissionais da pesca artesanal,  po
    meio de ações de resgate e valorização da cidadania.

  • SUZANA CARLA DA SILVA BITTENCOURT
  • Distribuição e abundância de ovos, larvas e juvenis de peixes em ecossistema de várzea, amazônia, Brasil.

  • Data: 28/03/2014
  • Mostrar Resumo
  • Este estudo analisou a composição e estrutura da assembleia de larvas e juvenis de peixes em região de várzea da Amazônia Central, na Reserva de Desenvolvimento Sustentável Mamirauá (RDSM), identificou diferenças espaciais e temporais, assim como analisou a influência do pulso de inundação e alguns fatores abióticos sobre estas espécies. As coletas foram realizadas durante a enchente, cheia, vazante e seca, utilizando-se uma rede cônica (300 μm) por meio de arrastos subsuperficiais na coluna d’água, com duração de cinco minutos e com uma rede retangular (1,5 x 1,0 m e malha de 500 µm), utilizada em bancos de vegetação flutuante. Os parâmetros abióticos foram mensurados in loco. As amostras foram coletadas em lagos e canais do sistema Mamirauá da RDSM durante os anos de 2010 e 2011, tanto em período diurno quanto noturno. Após a amostragem, o material biológico foi fixado, triado, contado e identificado ao menor nível taxonômico possível, seguindo a bibliografia especializada. O grupo dos Characiformes foi o mais representativo em todos os ambientes e em todos os momentos e períodos de coleta. Das 138 espécies identificadas, 37 são consideradas de importância comercial para a região. Em macrófitas aquáticas foram capturados 796 ovos de Callichthys callichthys (tamoatá). Neste mesmo hábitat 4.062 indivíduos (1.653 larvas e 2.409 juvenis) foram coletados e classificados em 128 espécies. Mesonauta insignis, Hoplias
    malabaricus, Serrasalmus spp. e Mylossoma duriventre foram as espécies dominantes. Em área de águas abertas foram capturadas 7.507 larvas de peixes, distribuídas em 32 espécies. A densidade média das larvas variou temporalmente, entre os quatro momentos do ciclo hidrológico e espacialmente, entre os tipos de ambientes estudados. Alguns taxa foram capturados exclusivamente nos ambientes de lagos e outros somente nos de canais, com destaque para as espécies
    Mylossoma duriventre, Tryportheus spp., Pimelodus spp. e Psectrogaster
    amazonica. Ocorreu variação das larvas capturadas (composição e abundância) entre as assembleias no ciclo diário (dia e noite). Dos 50 taxa identificados, 18 tiveram registro somente durante a noite e os demais ocorreram tanto de dia quanto de noite. Os resultados sugerem que a variação diária das larvas está ligada à sazonalidade, à disponibilidade de alimentos e ao comportamento larval ativo na coluna d’água. De maneira geral a variação fluviométrica, o oxigênio dissolvido na água e a temperatura da água foram as variáveis ambientais que melhor explicam o padrão de variação observado nas assembleias ictioplanctônicas estudadas.

  • AUGUSTO SOUSA MIRANDA
  • Produção de cana-de-açúcar nas condições climáticas Af
  • Data: 28/03/2014
  • Mostrar Resumo
  • A cultura da cana-de-açúcar desempenha importante papel socioeconômico no Brasil, apresentando como principais produtos o açúcar e álcool, além de ser utilizada como fonte de alimento volumoso nos sistemas de produção animal. Objetivou-se avaliar a cultura de cana- de-açúcar cultivada em condições climáticas tipo Af, caracterizado por precipitação pluviométrica em todos os meses do ano e ausência de estação seca. Foram determinados a composição químico bromatológica, características agronômicas e tecnológicas de três cultivares de cana-de-açúcar: IACSP93-6006, RB83-5486 e SP79-1011. Experimento foi realizado em delineamento em blocos casualizados, com três tratamentos e quatro repetições, sendo as médias comparadas pelo teste de Tukey ao nível de 5% de probabilidade. Houve diferença (P˂0,05) para matéria seca, extrato etéreo, proteína bruta, fibra em detergente ácido, lignina, celulose, fibra em detergente neutro corrigida para cinzas e proteína, carboidratos totais, fração B2, fração C e produção de matéria seca. Os componentes da porção fibrosa (FDNcp, LIG, fração C) apresentaram valores baixos, resultando em maior valor dos carboidratos não fibrosos, o que é interessante do ponto de vista da alimentação de bovinos, haja vista, que os componentes da porção fibrosa influenciam no consumo e digestibilidade do alimento. As cultivares apresentaram produção de matéria seca elevadas com destaque para as cultivares IACSP93-6006 e SP79-1011. Quanto às características agronômicas houve diferença (P˂0,05) para a produção de matéria natural, número de colmos, comprimento do colmo e diâmetro do colmo, com destaque para as cultivares IACSP93-6006 e SP79-1011, demonstrando adaptação às condições edafoclimáticas da região. Não houve diferença (P>0,05) para os atributos tecnológicos, Pol, °Brix, açúcares redutores, pureza, açúcares redutores totais, fibra e umidade, cujos valores foram baixos devido ao regime pluviométrico da região, pois a cana-de-açúcar necessita de estresse térmico ou hídrico para que ocorra a maturação. Nas condições do clima Af não há estação seca sendo que o mês menos chuvoso no período experimental apresentou 106,6 mm e a temperatura média de 26,8°C.
  • CAIO SANTOS SILVA
  • CARACTERIZAÇÃO DE POLIMORFISMOS NOS GENES DGAT1 E GH EM BÚFALAS (Bubalus bubalis).
  • Data: 11/03/2014
  • Mostrar Resumo
  • Os búfalos são animais domésticos pertencentes ao gênero Bubalus, família Bovidae da ordem Artiodactyla. Fornecem carne, leite e força de trabalho. São bastante adaptados as condições climáticas do estado do Pará, produzindo muito bem nessas condições. No entanto, os produtores ainda carecem de animais testados para características produtivas. Sendo assim utilizamos a técnica de SSCP (Polimorfismo de conformação de fita simples) e marcadores SNP (Polimorfismo de nucleotídeo único), com a finalidade de caracterizar os 83 animais das raças murrah e mediterrâneo. Para o DGAT1 encontramos as frequências alélicas de 0,741 para o alelo A, 0,253 para o alelo B e de 0,01 para o alelo C. As frequências genotípicas foram de 0,54 para o genótipo AA, 0,39 para o genótipo AB, 0,06 para o genótipo BB e de 0,01 para o genótipo AC. Para o gene GH encontrou-se apenas um genótipo. O gene DGAT1, mostrou considerável variação genética e detectou-se a presença de SNPs.
  • ALINE FERNANDA OLIVEIRA RAMOS
  • Valor nutritivo da torta de castanha-do-pará (Bertholletia excelsa Bonpl.) para
    alimentação de ruminantes

  • Data: 28/02/2014
  • Mostrar Resumo
  • A nutrição é um dos elos mais importante do processo produtivo, tanto pelos custos
    envolvidos quanto por estabelecer a eficiência e produtividade animal. Ao mesmo tempo a
    agroindústria brasileira encontra-se em plena expansão, com uso de oleaginosas,
    principalmente nos setores de cosmético e biodiesel, o que gera resíduos do processamento
    para obtenção do óleo. Dessa forma, o uso desses subprodutos na alimentação animal pode
    atender  a pecuária e a agroindústria,  pois constitui alternativa de  alimento de boa
    disponibilidade  regional  e baixo custo,  bem como  permite  a redução dos acúmulos e
    destinos inadequados desses resíduos. Antes de usar um novo alimento nas formulações de
    rações são necessárias medidas experimentais, a fim de determinar a composição química e
    avaliar as respostas dos  animais que  recebem o ingrediente na dieta,  tais  como consumo
    voluntário,  digestibilidade dos nutrientes e  comportamento animal,  o  qual  é importante
    para complementar e corroborar os  dados nutricionais, principalmente por  representar os
    efeitos da qualidade do alimento nas atividades digestivas.  Sendo assim, avaliou-se o
    subproduto do beneficiamento da amêndoa de castanha-do-pará  (Bertholletia excelsa
    Bonpl.), TC,  e seus efeitos sobre  o consumo voluntário, digestibilidade aparente e
    comportamento ingestivo apresentado por ovinos, em níveis crescentes de inclusão, 0, 15,
    30 e 60%, na  matéria seca da  dieta à base de silagem de milho. Foram utilizados 16
    cordeiros machos, inteiros com média de 33 kg e mantidos em gaiolas metabólicas
    individuais, que recebiam a dieta em duas refeições, às 8 e 18h, com a oferta ajustada para
    permitir 15% nas sobras. Amostras do fornecido, das sobras e das fezes foram coletadas e
    analisadas para determinação do consumo e digestibilidade aparente dos nutrientes.
    Durante quatro dias foi avaliado o comportamento ingestivo dos animais, em relação a suas
    atividades de alimentação, ruminação e ócio, ocorrências e duração de bolos ruminais e
    mastigações merícicas, além da eficiência em alimentação e ruminação.  A TC é um
    subproduto com potencial nutricional para ruminantes, com consideráveis teores de
    proteínas e lipídeos, mas em função do seu elevado teor de extrato etéreo, em níveis  de
    inclusão  superiores à 16,3% da dieta à base de  silagem de milho,  afetou  a fermentação
    ruminal, principalmente a digestibilidade da fibra e,  consequentemente, o consumo de
    matéria seca e o tempo em ruminação dos animais.

  • EZIQUIEL DE MORAIS
  • Óleo de palma na alimentação de ovinos, degradabilidade ruminal e
    digestibilidade aparente

  • Data: 28/02/2014
  • Mostrar Resumo
  • Foram estudados os efeitos de inclusões crescentes de óleo de palma nos parâmetros de
    degradação ruminal in situ dos nutrientes, matéria seca (MS), matéria orgânica (MO), proteína
    bruta (PB), fibra em detergente neutro (FDN), fibra em detergente ácido (FDA), da silagem de
    capim elefante e a digestibilidade aparente da MS, MO, PB, FDN, FDA e extrato etéreo (EE)
    das dietas experimentais  em ovinos.  Foram testados os seguintes tratamentos: inclusão de
    óleo de palma em 0, 25, 50, 75 e 100 g/kg MS da dieta total. As dietas constituíam de silagem
    de capim elefante e concentrado a base de milho, farelo de soja e mistura mineral, o óleo de
    palma foi misturado ao concentrado para facilitar a distribuição, mantendo-se uma  relação
    volumoso:concentrado de 1:1, formuladas  para serem isoprotéicas,  isofibrosas, porém não
    isoenergéticas  oferecidas na razão de 1.5% do peso vivo  (consumo restrito).  Não foram
    observadas semelhanças significativas (P>0.05)  nas variáveis de degradação ruminal
    avaliadas, até a inclusão de 75 g  de óleo /kg MS. A matéria orgânica apresentou redução
    linear na digestibilidade aparente, efeito contrário ao observado para o EE que apresentou
    aumento linear na digestibilidade aparente, os demais nutrientes não tiveram suas
    digestibilidades afetadas pelas inclusões de óleo de palma à dieta, e indica que essa fonte
    lipídica pode ser utilizada em níveis superiores às recomendações para inclusão de gordura
    livre à dieta de ruminantes.

  • SUELLEN DA GAMA BARBOSA MONGER
  • Ocorrência de anticorpos contra os vírus da leucose enzoótica bovina, rinotraqueíte
    infecciosa bovina e diarreia viral bovina em bubalinos (Bubalus bubalis) no Estado do
    Pará

  • Data: 28/02/2014
  • Mostrar Resumo
  • A  leucose bovina, a  diarréia viral bovina  e a rinotraqueite  infecciosa  bovina estão  entre as
    principais  viroses  que levam a  perdas na produtividade e no desempenho reprodutivo de
    ruminantes. Embora bovinos e bubalinos sejam frequentemente criados em conjunto e apesar
    da  comprovada ocorrência  dessas enfermidades em bubalinos,  trabalhos  sobre ocorrência
    natural dessas viroses nessa espécie ainda são escassos. Deste modo, objetivou-se verificar a
    ocorrência de anticorpos contra os vírus da Leucose enzoótica bovina (LEB), Diarreia viral
    bovina (BVD) e Rinotraqueíte  infecciosa bovina (IBR) em bubalinos de criações localizadas
    nas Mesorregiões Nordeste Paraense, Metropolitana de Belém e do Marajó, no Estado do
    Pará, além de identificar os fatores de risco para a  BVD em criações  das Mesorregiões
    Nordeste Paraense e Metropolitana de Belém. No presente estudo foram avaliados 350 soros
    de  bubalinos (Bubalus  bubalis) procedentes de propriedades agropecuárias localizadas nas
    respectivas mesorregiões, que foram submetidos às  técnicas de sorologia:  imunodifusão para
    LEB  e  soroneutralização para  BVD  e  IBR.  A frequência  para as respectivas doenças  na
    população  de estudo  foram: 0% (0/350), 53,71% (188/350) e  91,71% (321/350). Bubalinos
    machos e animais com idade mais avançada apresentaram maior soropositividade para BVD.
    A frequência de bubalinos sororreagentes para BVD foi maior na Mesorregião do Marajó, em
    relação às Mesorregiões Nordeste Paraense e Metropolitana de Belém, enquanto para IBR foi
    maior nas Mesorregiões Nordeste Paraense e Metropolitana de Belém. Dentre as variáveis
    investigadas, o tipo de ordenha foi o único identificado como fator de risco para a ocorrência
    da BVD em bubalinos.

  • MICHEL DOS SANTOS MORAES
  • Torta de cupuaçu (Theobroma grandiflorum) e de murumuru (Astrocarium murumuru) na suplementação de búfalas em lactação, em Belém, Pará

  • Data: 28/02/2014
  • Mostrar Resumo
  • Os subprodutos torta de cupuaçu (Theobroma grandiflorum) e torta de murumuru (Astrocarium murumuru) disponíveis na agroindústria da Amazônia Oriental podem ser utilizados como alternativa na substituição de concentrados convencionais. Porém, com poucas informações a respeito do potencial desses ingredientes, este trabalho visou avaliar o consumo, digestibilidade aparente e comportamento ingestivo de búfalas lactantes suplementadas com concentrado contendo torta de cupuaçu ou torta de murumuru. O trabalho foi desenvolvido na Unidade de Pesquisa Animal (Senador Álvaro Adolpho), da Embrapa Amazônia Oriental, em Belém, Pará. Foram utilizados doze fêmeas bubalinas lactantes, distribuídas em quatro quadrados latinos simultâneos 3x3, alocadas em área de 14 ha, dividida em oito piquetes (1,75 ha) com capim Panicum maximum cv. mombaça, manejado em sistema de pastejo rotacionado, com quatro dias de ocupação e 28 dias de descanso, com ciclo de pastejo de 32 dias, com água e sal mineral ad libtum. Os tratamentos experimentais foram a substituição parcial do milho e do farelo de soja pelas tortas de cupuaçu ou murumuru: Controle (FMS) - 75% de farelo de milho e 25% de farelo de soja; Cupuaçu (CUP) - 30% de farelo de milho, 20% de farelo de soja e 50% de torta de cupuaçu; e Murumuru (MUM) - 39% de farelo de milho, 24% de farelo de soja e 37% de torta de murumuru. Os concentrados foram ofertados duas vezes por dia de acordo com a produção diária de leite, sendo um kg de concentrado para animais que produziram até cinco kg de leite/dia, sendo adicionado mais um kg de concentrado para cada dois kg de leite produzido, acima de cinco kg. O estudo do comportamento ingestivo das búfalas em pastejo foi realizado a cada 21 dias, durante 24h, em intervalos regulares de cinco minutos, de forma visual, sendo observado o tempo despendido em ócio (TO), ruminação (RU) e pastejo (PA). Os resultados foram submetidos à análise de variâncias, com comparações de médias feitas por Teste Tukey a 5% de probabilidade. Os valores para consumo de matéria seca (CMS), matéria orgânica (MO) e de proteína bruta (PB) não diferiram (P>0,05) entre os tratamentos, assim como os consumos de volumoso (CVol), com média de 5,86 kgMS, e 51,80 g/kg0,75 e concentrado (CConc), com média de 1,84 kgMS. O uso das tortas de cupuaçu e murumuru ocasionaram aumento no consumo de EE, FDNcp e FDAcp. Não houve diferença (P<0,05) entre os coeficientes de digestibilidade aparente da matéria seca (MS), matéria orgânca (MO) e proteína bruta (PB) entre as dietas ofertadas. No entanto, houve aumento (P>0,05) entre as dietas alternativas para os coeficientes de digestibilidade aparente do extrato etéreo (EE), da fibra em detergente neutro (FDN), fibra em detergente ácido (FDA), quando comparadas com a dieta controle. A produção de leite não variou (P<0,05) entre as dietas, com médias de 6,67 kg/búfala/dia e média de produção de leite corrigido para 4% de gordura de 9,57 kg/búfala/dia. Os tempos médios desprendidos em ruminação e ócio foram maiores (P>0,05) para os animais que se alimentaram com dietas à base de tortas de cupuaçu e murumuru. Concentrados à base dessas tortas podem ser utilizados para a suplementação de búfalas leiteiras em sistema de pastejo rotacionado.

  • VANDERSON VASCONCELOS DANTAS
  • Caracterização dos sistemas de produção na bovinocultura leiteira nas mesorregiões
    sudeste e nordeste paraense

  • Data: 25/02/2014
  • Mostrar Resumo
  • A pecuária leiteira assume grande importância na economia regional, do ponto de vista
    de ocupação e geração de renda, sobretudo para agricultura familiar. Conhecer a realidade
    desses sistemas torna-se fundamental para que se possam gerar subsídios específicos para
    maior desenvolvimento da atividade. Nesse contexto os estudos sobre os diferentes sistemas
    de produção despontam como uma ferramenta relevante. O objetivo deste trabalho foi
    caracterizar os sistemas de produção de leite nas mesorregiões do sudeste e nordeste paraense
    através da utilização de técnicas de análise multivariada. A pesquisa foi realizada através da
    aplicação de questionários a 112 propriedades localizadas nos municípios de Ulianópolis-PA
    e Irituia-PA. Os dados obtidos foram tabulados no Microsoft Excel e processados no software
    SPSS 18.0. Através da análise de frequência observou-se que a área total das propriedades
    variou de 7 a 1600 ha. Os proprietários  foram classificados de acordo com a quantidade de
    vacas existentes nas propriedades e constatou-se que 5,35% dos produtores possuíam menos
    de 10 vacas e 23,21% mantinham em seus estabelecimentos mais de 50 vacas. Com relação à
    produtividade do rebanho  observou-se  uma média geral de 4,34  (L vaca
    -1
    dia
    -1
    ). A
    alimentação do rebanho é baseada em pastagens cultivadas, sendo o braquiarão a mais
    utilizada. Apenas 19,60% das propriedades realizam suplementação com concentrado e
    13,39% com volumoso. O manejo reprodutivo é realizado em 86,6% através de monta natural
    sem nenhum controle, o que resulta em animais pouco especializados para produção leiteira.
    O manejo da ordenha apresenta-se deficiente quanto às condições higiênica-sanitária,
    resultando num produto de baixa qualidade. As práticas de gestão apresentam pouca
    expressão entre os produtores. Com relação à tipologia estabelecida através da análise fatorial,
    revelou-se quatro fatores que explicaram 66,99% das variáveis originais, sendo que a análise
    de cluster identificou 4 grupos de produtores com perfis similares. O grupo III correspondeu
    ao grupo de produtores que apresentou maior adoção de tecnologia, como suplementação
    alimentar, manejo sanitário, tecnologia da ordenha e gestão da atividade, possuindo
    consequentemente melhor desempenho com média de produtividade de 5,04 (L vaca
    -1
    dia
    -1
    ).
    Os grupos I  e II  caracterizam-se  por sistemas de produção familiares,  com baixo nível de
    especialização e baixa produtividade e o grupo IV consiste em produtores familiares  que
    apresentaram uma produção incipiente com participação da agricultura, possuindo os menores
    rendimentos produtivos e econômicos.

  • CRISTIANE SOARES SIMON MARQUES
  • Perfil de consumidores e potenciais consumidores da carne de búfalo na cidade de
    Belém-PA-Brasil

  • Data: 24/02/2014
  • Mostrar Resumo
  • O presente trabalho buscou explorar e caracterizar os principais elementos de
    percepção dos consumidores ou potencias consumidores da carne bubalina quanto
    ao seu comportamento, perfil, questões culturais e sociais, além de testar o seu
    conhecimento quanto aos atributos deste produto. Fatores limitantes, oportunidades
    e os desafios do mercado na cidade de Belém capital do  estado do Pará também
    foram abordados neste trabalho. Foi realizada uma pesquisa do tipo  survey ou de
    avaliação  classificada como confirmatória, exploratória e descritiva quanto ao seu
    propósito, através da aplicação de um questionário semiestruturado complementado
    por uma análise sensorial pareada afetiva de carne bovina e carne bubalina
    respectivamente. Ficou evidenciado que existe um mercado promissor para a carne
    de búfalo na cidade de Belém, desde de que sejam tomadas ações para melhorar a
    distribuição da carne bubalina de forma regular nos pontos de venda e ações
    conjuntas para divulgar as características benéficas deste produto  com o apoio de
    instituições públicas e privadas envolvidas na cadeia de produção.  Quanto ao
    resultado da segmentação de mercado foram identificados quatro clusters distintos,
    sendo estes: grupo I dos “Jovens e interessados”, grupo II  “Misto e indiferentes”,  
    grupo III dos “Graduados e bem sucedidos” e o grupo IV das “Mulheres saudáveis”.
    Todos os grupos apresentaram respostas positivas com relação à carne bubalina, no
    entanto os Clusters I e III destacaram-se em vários indicadores da pesquisa
    principalmente com relação a sua preferência e pré-disposição para compra e
    inclusão da carne de búfalo nas suas refeições. O grupo II embora tenha
    apresentado vários dados positivos frente a suas avaliações da carne bubalina é o
    grupo que menos tem interesse em incluir a carne de búfalo em seu cardápio. O
    grupo IV destacou-se por ser representado por mulheres em sua maioria as quais
    souberam destacar as qualidades da carne bubalina em relação as suas
    características nutricionais.

  • LEOPOLDO AUGUSTO MORAES
  • Ocorrência de Micoplasmas Hemotrópicos em Caninos e Felinos Domésticos na Região de Belém, PA
  • Data: 07/02/2014
  • Mostrar Resumo
  • Micoplasmas hemotrópicos compreendem um grupo de bactérias que podem causar anemia hemolítica e diversas doenças crônicas em animais. Em felinos três espécies infectantes de hemoplasmas são relatadas: Mycoplasma haemofelis, ‘Candidatus M. haemominutum’ e ‘Candidatus M. turicensis’, sendo o primeiro considerado mais patogênico, enquanto que os caninos são normalmente infectados por pelo menos duas espécies de micoplasmas: M. haemocanis e ‘Candidatus M. haematoparvum’. Com o objetivo de avaliar a ocorrência de micoplasmas hemotrópicos em população canina e felina da cidade de Belém, Estado do Pará, foi analisado através de PCR o material genético oriundo de 299 amostras sanguíneas de animais domiciliados e errantes. Em 8,03% (24/299) das amostras foi amplificado o DNA de micoplasmas hemotrópicos, sendo 1,78% (3/169) de cães e 16,15% (21/130) de gatos infectados. Entre os felinos as maiores taxas de infecção foram encontradas nos animais domiciliados 22,86% (16/70) e em animais machos 29,51% (18/61), sendo a espécie ‘Candidatus M. haemominutum’ 8,46% (11/130) a de maior ocorrência quando comparada a espécie M. haemofelis 6,92% (9/130). A infecção em caninos foi observada somente no grupo de animais errantes, sendo o ‘Candidatus M. haematoparvum’ a única espécie identificada com taxa de 1,78% (3/169). Foi possível avaliar que micoplasmas hemotrópicos circulam nas duas espécies estudadas, felinos domiciliados e machos formaram o grupo com maior risco para a infecção e que o bioagente ‘Candidatus M. haematoparvum’ parece ser o único em circulação na população canina.
2013
Descrição
  • LILIAN DE NAZARE SANTOS DIAS
  • FAUNA MICROPARASITÁRIA DE Brachyplatystoma rousseauxii E Mugil curema
    DESEMBARCADOS NA AMAZÔNIA ORIENTAL

  • Data: 29/11/2013
  • Mostrar Resumo
  • A dourada Brachyplatystoma rousseauxii e a pratiqueira Mugil curema são espécies de
    peixes de considerável consumo e valor  comercial encontrados na costa estuarina do estado
    do Pará. Os microparasitos dos filos Apicomplexa, Microspora e Myxozoa são organismos
    que podem ser encontrados parasitando vertebrados e invertebrados, entre eles os peixes,
    alguns com potencial patogênico,  zoonótico  podendo acarretar  impactos  econômicos. Para
    conhecer a fauna miroparasitária que acomente peixes, 62 exemplares de B. rousseauxii e 58
    de M. curema capturados na costa estuarina do município de Vigia de Nazaré e do Distrito de
    Mosqueiro,  município de Belém, estado do Pará foram examinados conforme métodos e
    técnicas de análise morfológica (microscopa de luz), ultraestrutural (microscopia eletrônica de
    transmissão) e de biologia molecular (análise filogenética). Foi observada a ocorrência de três
    filos (três em  B.  rousseauxii  e dois em M. curema)  nos hospedeiros capturados nas duas
    localidades, mais o maior índice parasitário foi determinado nos exemplares das duas espécies
    capturados na costa estuarina do município de Vigia de Nazaré, com maior ocorrência de
    microparasitos dos filos Apicomplexa e Myxozoa, além do multiparasitismo em  B.
    rousseauxii, a análise morfológica  revelou a presença de Calyptospora  sp. (Apicomplexa),
    Ellipsomyxa sp., Henneguya sp., Myxobolus sp. e Meglishcha sp. (Myxozoa) e Kabatana sp.
    (Microspora) em B. rousseauxii e Ellipsomyxa sp., Myxobolus sp. e um microparasito do filo
    Microspora em  M. curema. Os dados das  análises  morfológicas e ultraestruturais  dos
    Myxospora encontrados em B. rousseauxii e M. curema são sugestivos de novas espécies de
    microparasitos nesses dois hospedeiros. Os dados da análise filogenética não forneceram
    resultados que permitiram  a classificação de  Kabatana  sp. (Microspora) e  Henneguya  sp.
    (Myxozoa) encontrados parasitando B.  rousseauxii   como novas espécies de microparasitos
    nesse hospedeiro devido ao baixo valor de  bootstrap, mas pela análise da distância  p  foi
    possível sugerir que se tratam de novas espécies. Estudos a respeito de microparasitos em
    peixes amazônicos são necessários  para o conhecimento das ocorrências, caracterização de
    novas espécies, potencial patogênico nos hospedeiros e eventual risco para o consumidor.

  • MARCOS FERREIRA BRABO
  • AVALIAÇÃO DA SUSTENTABILIDADE DE UM PARQUE AQUÍCOLA
    CONTINENTAL NA AMAZÔNIA ORIENTAL BRASILEIRA 

  • Data: 08/11/2013
  • Mostrar Resumo
  • A demarcação de parques aquícolas em grandes reservatórios de domínio da União constitui- se na principal política do Ministério da Pesca e Aquicultura para incrementar a produção brasileira de pescado. No entanto, a capacidade destes empreendimentos em promover o desenvolvimento local de forma sustentável tem sido frequentemente contestada por órgãos ambientais e especialistas do setor. Este estudo teve o objetivo de avaliar a sustentabilidade do parque aquícola de Breu Branco III no reservatório da Usina Hidrelétrica de Tucuruí, Estado do Pará. Indicadores de sustentabilidade nas dimensões ambiental, econômica e social foram definidos, validados e mensurados por meio de revisão de literatura, observações in loco e entrevistas com atores sociais em excursões bimestrais ao parque aquícola de Breu Branco III no período de agosto de 2010 a julho de 2012. A proposta elaborada contou com 21 indicadores de sustentabilidade, sete em cada dimensão, responsáveis em formar seus respectivos subíndices e constituir um índice de sustentabilidade. Por meio dela, Breu Branco III foi classificado como pouco sustentável, com o subíndice econômico sendo o que mais acentuou a insustentabilidade, seguido dos subíndices social e ambiental, respectivamente. Neste contexto, procedeu-se uma análise econômica da piscicultura com 8, 16 e 24 tanques- rede em áreas aquícolas não onerosas, utilizando a estrutura de custo operacional e indicadores de viabilidade econômica. A avaliação econômica dos três portes de empreendimento estimou o custo operacional total por kg em R$ 6,59, R$ 6,13 e R$ 5,99, a taxa interna de retorno em 8%, 22% e 27% ao ano e o período de retorno do capital em 6,5, 3,8 e 3,3 anos, respectivamente. A menor contribuição da dimensão econômica para a sustentabilidade do parque aquícola de Breu Branco III foi motivada pela desestruturação da cadeia produtiva da piscicultura na região e apesar de constatada a viabilidade dos projetos, seus indicadores econômicos desestimulam a implantação de novos empreendimentos em áreas aquícolas não onerosas.
     
     
  • ANA PATRICIA MOREIRA SELESKI
  • RESPOSTA IMUNE HUMORAL DE BUBALINOS (Bubalus bubalis) VACINADOS
    PELA CEPA B19 DE Brucella abortus

  • Data: 31/08/2013
  • Mostrar Resumo
  • A brucelose está distribuída em todo território nacional, com maior prevalência para a espécie
    Brucella abortus  que apesar de ser endêmica, apresenta-se de forma heterogênea entre as
    diferentes regiões do Brasil. O presente estudo tem por objetivo avaliar a resposta imune
    humoral de bezerras bubalinas criadas na Mesorregião do Médio Amazonas, vacinadas com a
    cepa B19 de  B. abortus  na idade preconizada pelo Programa Nacional de Controle e
    Erradicação da Brucelose e Tuberculose (PNCEBT). Foram selecionadas e acompanhadas 36
    fêmeas (grupo teste) e 6 machos (grupo controle) com idades entre 3-8 meses. No dia 0 foi
    coletado sangue de todos os animais, em seguida todas as fêmeas receberam vacina comercial
    com amostra B19 em dose padrão conforme orienta o PNCEBT, com posteriores coletas de
    sangue  realizadas aos 30, 60, 90, 120, 150, 180, 210, 330, 360 e 390 dias. Os soros
    sanguíneos foram avaliados pelo soro aglutinação das provas de triagem: Antígeno
    Acidificado Tamponado  -  AAT e pela prova confirmatória: 2 Mercaptoetanol  -  2ME. Os
    resultados obtidos para todas as amostras coletas no dia 0 apresentaram resultado negativo na
    reação. Aos 30 e 60 dias todas as fêmeas apresentaram 100% de reação na prova AAT e
    titulação de 1:200, iniciando o declínio da titulação aos 90 dias nas duas provas. Aos 210 dias
    as fêmeas ainda reagentes apresentaram resultados similares nas duas provas, tendo apenas
    um animal se mantido reativo nas duas provas até 360 dias e, somente aos 390 dias 100% das
    fêmeas obtiveram reação negativa nas duas provas, durante todo o experimento os machos
    foram não reativos. Assim, pela avaliação dos resultados, a vacinação mostrou-se eficaz para
    a imunização, sendo uma ferramenta importante na profilaxia da brucelose na espécie
    estudada, bem como as provas aplicadas para o diagnostico dessa enfermidade em búfalos a
    nível regional.

  • DÁRIO LISBOA FERNANDES NETO
  • Determinação de Níveis de Cálcio e Fósforo na Dieta de Muçuãs (Kinosternon scorpioides) em Cativeiro
  • Data: 23/08/2013
  • Mostrar Resumo
  • Na Amazônia o consumo de quelônios é muito mais do que uma simples maneira de se obter carne ou proteína é, também, parte da cultura. A criação em cativeiro de forma comercial é fundamental para combater a caça predatória e, consequentemente, evitar a extinção das espécies. Um maior conhecimento das exigências alimentares, quanto aos minerais, podem servir de base para formulações em dietas de quelônios, como alternativas para corrigir deficiências destes compostos nas rações fornecidas em cativeiro. Assim neste estudo objetivou- se determinar os níveis de cálcio para fase inicial e crescimento e níveis cálcio e fósforo e sua relação na fase adulta para muçuãs (Kinosternon scorpioides). Na fase inicial e de crescimento o delineamento foi Inteiramente casualizado, com cinco níveis de cálcio (4.7, 5.2, 5.7, 6.2 e 6.7%) com fósforo a 3,0%, com três repetições, contendo 4 e 2 animais por unidade experimental, respectivamente. Na fase adulta o delineamento foi inteiramente casualizado em esquema fatorial 5x3, cinco níveis de cálcio (5.0, 5.7, 6.4, 7.1 e 7.7%) e três níveis de fósforo (2.6, 3.0, e 3.4 %), com três repetições contendo três animais por unidade experimental. Quinzenalmente os animais foram submetidos a pesagem e a biometria. Os dados foram processados utilizando análise de regressão por superfície de resposta. Na fase inicial a variação dos níveis de cálcio não influenciou nas variáveis respostas, sendo absorvido e desviado para o fortalecimento das partes osseas. Na fase de crescimento, o cálcio absorvido foi destinado ao desenvolvimento corporal dos muçuãs recomendando-se